Bacterial Transcription: Promoters, RNA Polymerase Subunits, Termination, and Rifampicin, Assignments of Biology

Download Bacterial Transcription: Promoters, RNA Polymerase Subunits, Termination, and Rifampicin and more Assignments Biology in PDF only on Docsity! Name (Last, First): Discussion Unique No.: Discussion Questions Set #8 October 25 2005 Please turn in a printed/written copy of the questions with the answers to two questions for the next discussion session. Transcription 1. Define promoter and discuss general DNA elements that are found in bacterial promoters. 2. Describe functions of different subunits of bacterial RNA polymerase- σ, α, β, and β’ and specify their relative locations on DNA to initiate transcription. 3. What is the advantage of having more than one σ factor in a bacterial cell? 4. Define terminator and compare ρ-dependent and ρ-independent termination. 5. How does rifampicin affect transcription? 6. Given below are two double-stranded DNA fragments (A and B): A. 5’ ATCGAGTCTTGACATGGCTACAGTTGTATAATACGTAGCATGGGGGG 3’ 3’ TAGCTCAGAACTGTACCGATGTCAACATATTATGCATCGTACCC CCC 5’ B. 5’ AAAAAAATGCTACGTATTATACAACTGTAGCCATGTCAAGACTCGAT 3’ 3’ TTTTTT TACGATGCATAATATGTTGACATCGGTACAGTTCTGAGCTA 5’ a. Transcribe these DNA sequences and mark -35, -10, +1 sites and 5’ and 3’ ends on your transcripts . b. Indicate which DNA strands (top or bottom) you used as templates to get