Understanding Genetic Mutations: Types, Effects, and Implications, Assignments of Biology

Download Understanding Genetic Mutations: Types, Effects, and Implications and more Assignments Biology in PDF only on Docsity! Genetic Mutations POGIL What mistakes can occur when DNA is replicated? Why? The genes encoded in your DNA result in the production of proteins that perform specific functions within your cells. Various environmental factors and spontaneous events can lead to changes in genes. These changes, called mutations, can lead to alterations in the structure and activity of the proteins your cells use in their daily activities. In other words, changes to your genotype can result in changes to your phenotype. We all have mutations in most of our body cells—yet we are, for the most part, normal and functional human beings. How can that be? 1. How many nucleotides are present in the “normal” DNA sequence in Model 1? 21 nucleotides are present in the “normal” DNA sequence. 2. How many codons are contained in the mRNA that is produced by the “normal” DNA in Model 1? 7 codons are contained in the mRNA produced by the “normal” DNA. 3. How many amino acids will be in the polypeptide produced by the normal DNA/mRNA sequence? (You can think of a polypeptide as an unfinished protein.) 6 amino acids will be in the polypeptide. 4. What is the amino acid sequence of the polypeptide produced by the “normal” DNA sequence in Model 1? The amino acid sequence of the polypeptide is Met, His, Gln, Trp, Lle, Thr. (AUGCAUCAGUGGAUUACCUAG) 5. Consider DNA sequence 2 in Model 1. The mutation in that sequence is a substitution mutation. a. Compare sequence 2 with sequence 1 and describe the mutation that has occurred. Although sequence #1 and sequence #2 have the same number of nucleotides (21), sequence two had the original nucleotide of C replaced with the nucleotide of G. This resulted in sequence #2 having one different codon compared the the “normal” #1 sequence. UGG UCG → Trp Ser b. What is the effect of this substitution mutation on the amino acid sequence? The effect of this substitution mutation on the amino acid sequence (original C → G) is an entirely new/different codon compared to the original #1 amino acid sequence. (Trp → Ser) 6. Consider DNA sequence 3 in Model 1. The mutation in that sequence is an insertion mutation. a. Compare sequence 3 with sequence 1 and describe the mutation that has occurred. Although sequence #1 and sequence #3 have the same first two amino acids, sequence #3 has entirely new/different amino acids after them. Sequence #3 had an additional nucleotide of T inserted after the codon of “GTA”. b. What is the effect of the insertion mutation on the amino acid sequence as compared to the “normal” amino acid sequence in Model 1? The effect of sequence #3 having an additional nucleotide is 5 entirely different amino acids and the “stop” codon being pushed further back compared to the original sequence #1. 7. Consider DNA sequence 4 in Model 1. The mutation in that sequence is a deletion mutation. a. Compare sequence 4 with sequence 1 and describe the mutation that has occurred. 17. Gene mutations can be positive, negative or neutral. Suppose that the normal gene in Model 2 produced a polypeptide that was necessary for cellular respiration. a. Choose a mutation from those in Model 2 that would be neutral for a cell. Explain your reasoning. Mutation B would be neutral for a cell because all of the produced amino acids would be the exact same as the original/normal sequence. b. Choose a mutation from those in Model 2 that might be positive for a cell. Explain your reasoning. Mutation A would be positive for a cell because it changes from the original DNA, leading to new versions of proteins that actually help the organism adapt to changes in their environment. c. Choose a mutation from those in Model 2 that might be negative for a cell. Explain your reasoning. Mutation C would be negative for a cell because it comes to a stop so early and will subsequently cause a harmful mutation such as genetic disorders. - The protein structure is different and causes a harmful mutation. Read This! Mutations are the source of all new alleles in nature. Variations in alleles lead to variations in organisms within a population. Positive mutations lead to the organism having a better chance of survival, which means the mutation may be passed on to the offspring. Negative mutations may lead to an early death— probably before the organism can produce offspring. Therefore, changes in alleles from one generation to another form the basis of evolution . 18. Which types of mutations, positive, negative or neutral, are most likely to be seen in offspring several generations after the mutation occurred? Explain your reasoning. Positive and neutral mutations are most likely to be seen in offspring because the carrier of those positive or neutral mutations lived long enough to produce offspring. However, this would not be the case if the organism had a negative mutation because they likely would not be able to live long enough to actually produce offspring and pass down the negative/harmful mutation. 19. Consider the following scenarios. State whether the mutation is likely to be passed on to the offspring of the organism. Explain your reasoning. a. A single bacteria cell contains a positive mutation in its DNA. Likely to be passed on because it’s a positive mutation and the replication process produces an offspring that is identical genetically to the parent. - Benefiting them in survival b. A skin cell on a cat contains a positive mutation in its DNA. Not likely to be passed on because the skin cell is not involved during the replication process. c. A sperm cell in a whale contains a positive mutation in its DNA. Likely to be passed on because it directly gets passed through the replication process (meiosis). 20. All cells have DNA errors, due to the mistakes that occur each time DNA is replicated prior to cell division. There are proof-reading enzymes in cells that correct many of these mistakes, but on average, 3 – 5 errors are found in DNA after each replication. a. If each cell has multiple mutations, why do most of us have normally-functioning tissues and organs? Most of us have normally functioning tissues and organs because there are many different genetic variations. And there are beneficial ones, not all have a negative effect on the human body or organism. Not all mutations are bad such as DNA replication and ATP. An example of this would be how certain mutations have protected people from heart disease, resulting in them actually living and not dying. b. Why is only a tiny subset of these mutations passed on to our children? Only a tiny subset of these mutations pass onto our children because of the changes in the sequences of genes in DNA. - They’re one source of genetic variation. Another source is the movement of genes between different organisms. This means that only mutations in the egg and sperm cells are passed down. 21. A gene mutation is a change in the sequence of nucleotides that occurs during cell replication (mitosis and meiosis) within a single coding section of DNA. Mistakes can also occur in the transcription of mRNA or the translation of a polypeptide. However, these changes are not considered to be mutations, because they are not permanent changes to the cell. Explain why “mistakes” in transcription or translation are not as serious as mutations in a gene. Mistakes in transcription/translation are less serious than mutations in a gene because they are usually temporary and don’t permanently alter the DNA sequence. The redundancy of the genetic code provides tolerance/boundaries for errors, and small mistakes that may not significantly impact the function of the resulting protein. However, gene mutations also involve permanent changes to the DNA sequence with potential long-term consequences. 22. Insertion and deletion mutations are said to cause shifts in the “reading frame” (the sets of three nucleotides) of the mRNA. Substitution mutations do not cause these so-called frameshifts. Explain why insertions and deletions are called frameshift mutations, using the terms reading frame, codons, and amino acids in your answer. Insertion and deletion mutations are called frameshift mutations because they disrupt the reading frame by changing the grouping of codons. This alteration in the codon sequence can often lead to a different sequence of amino acids in the synthesized protein, possibly affecting the structure & function. Substitution mutations, however, don’t cause frameshifts because they usually involve the replacement of just a single nucleotide without completely altering the three nucleotide structure.