Certified Histocompatibility Specialist Practice Exam, Exams of Nursing

Download Certified Histocompatibility Specialist Practice Exam and more Exams Nursing in PDF only on Docsity! CHS Practice Exam (Certified Histocompatibility Specialist) Questions With Complete Solutions. Which of the following is not a secondary lymphoid organ? a. Spleen b. Thymus c. Lymph nodes d. Liver e. Tonsils Answer- Thymus Primary lymphatic organs are where lymphocytes are formed and mature. stem cells to divide and mature into B- and T- cells: There are two primary lymphatic organs: the red bone marrow and the thymus gland. Which of the following is not a component of the reticuloendothelial cell system? a. Microglial cells b. Kupffer cells c. Langerhans cells d. Neutrophils e. Monocytes Answer- Neutrophils Macrophages = tissue Monocytes = blood Kupffer cells = liver Microgial cells = nervous system Langerhans = skin Not = endothelial cells, fibroblasts, and most leukocytes Opsonization is a term to describe what? a. Lysis of bacteria b. Coating of bacteria c. Ingestion of bacteria d. Killing of bacteria e. Phagocytosis Answer- Coating of bacteria Antibody opsonization is the process by which a pathogen is marked for ingestion and eliminated by a phagocyte. Which of the following does not describe a role of antibodies in host defense? a. They serve as a bridge between bacteria and phagocytes b. They lyse bacteria c. They enhance complement binding to the bacterial cell wall d. They prevent viruses from infecting cells e. They bind pathogens in mucus secretions Answer- They lyse bacteria MHC Class I and II molecules differ in all of the following except a. Types of T cells they stimulate b. Types of cells they are expressed on c. Which chromosome they are located on d. Types of antigens they present e. Whether or not they have foreign peptides in the antigen-binding groove Answer- Which chromosome they are located on The primary role of the proteasome in antigen presentation is to a. Prevent premature folding of MHC class I molecules b. Process cytoplasmic proteins c. Degrade recycled MHC molecules d. Bind HLA-DM in the endosome e. Chaperone peptides to the cell surface Answer- Process cytoplasmic proteins The main function of the proteasome is to degrade unneeded or damaged proteins by proteolysis, a chemical reaction that breaks peptide bonds. Peptides that bind to MHC class I molecules differ from peptides that bind to MHC class II molecules in all except which of the following ways? a. They are shorter b. They were processed by different proteases c. They anchor in the middle instead of the end of the MHC molecule d. They interact with different subsets of T cells Answer- They anchor in the middle instead of the end of the MHC molecule HLA-DM is primarily involved in the a. Activation of cytotoxic T cells b. Loading antigen onto HLA-DR molecules c. Preventing HLA-A molecules from folding prior to antigen binding d. Rejection of islet grafts e. Induction of diabetes mellitus Answer- Loading antigen onto HLA-DR molecules The antigen-binding site of an antibody is comprised of which of the following? a. The variable region of the light and heavy chains b. The variable region of the light chain only c. The entire light chain d. The entire heavy chain e. The Fc portion of the immunoglobulin molecule Answer- The variable region of the light and heavy chains The immunoglobulin that binds the most complement is a. IgA b. A1, A24, B7, B8, DR1, DR17 c. A24, A68, B7, B64, DR1, DR7 d. A11, A29, B38, B62, DR4, DR7 e. A1, A3, B35, B55, DR1, DR4 Answer- A24, A68, B7, B64, DR1, DR7 A2 = A2, 9, 28, B17 | A9 = 23, *24* and A28 = *68*,69 A patient with an anti-HLA-Bw4 antibody would be most likely to have a positive T cell crossmatch with which of the following donors? a. A1, A3, B8, B35, DR4, DR17 b. A1, A24, B7, B8, DR1, DR17 c. A24, A68, B7, B64, DR1, DR7 d. A11, A29, B38, B62, DR4, DR7 e. A1, A3, B35, B55, DR1, DR4 Answer- A11, A29, *B38*, B62, DR4, DR7 A patient with an anti-HLA-B8 CREG antibody might be expected to have a positive T cell crossmatches with all of the following donors *except*? a. A1, A3, B8, B35, DR4, DR17 b. A1, A24, B7, B8, DR1, DR17 c. A24, A68, B7, B64, DR1, DR7 d. A11, A29, B38, B62, DR4, DR7 e. A1, A3, B35, B55, DR1, DR4 Answer- a. A1, A3, *B8*, B35, DR4, DR17 b. A1, A24, B7, *B8*, DR1, DR17 c. A24, A68, B7, *B64*, DR1, DR7 (part of B14) d. A11, A29, *B38*, B62, DR4, DR7 (part of B16) *e*. A1, A3, B35, *B55*, DR1, DR4 Rita doesn't understand; the B55 is part of the CREG A positive AHG T cell crossmatch between an untransfused male recipient and non- beaded spleen cells from the donor is most likely due to a. Anti-Bw6 b. Macrophage contamination c. Auto antibodies d. CYNAP antibodies e. Anti-HLA-DQ antibodies Answer- Macrophage contamination - why not auto antibodies A positive B cell crossmatch does not usually lead to hyperacute renal allograft rejection because a. There are very few B cells in the transplanted kidney b. These antibodies are of low affinity c. These antibodies are of low avidity d. The vascular endothelium expresses very little HLA class II antigens e. The antibodies are usually in low titer Answer- The vascular endothelium expresses very little HLA class II antigens Among the HLA-Class II molecules a. Most polymorphism exists in exon 1 of the B chain b. Most polymorphism exists in exon 2 of the A chain c. DRB3, DRB4 and DRB5 are the most polymorphic d. The DRA chain can combine with several different DRB chains e. Only the B chain makes up the peptide binding site Answer- The DRA chain can combine with several different DRB chains If the frequencies of alleles A and B are 0.2 and 0.6, respectively, what is the probability of an AA child in a mating of AB x AB parents? a. 0.004 b. 0.012 c. 0.25 d. 0.50 e. 0.80 Answer- 0.25 A positive MLC between a brother and sister who are both typed as HLA-DR4,- is most likely due to a. The siblings not being HLA-identical b. A meiotic crossover between HLA-DR4 alleles c. A proliferative response to HLA class I alleles d. High background in the MLC e. Somatic hypermutation Answer- The siblings not being HLA-identical Failure of bone marrow engraftment could be due to all of the following except... a. Insufficient preparative chemotherapy to the patient b. A positive crossmatch c. A graft that has too few CD34+ cells d. ABO-mismatched donor cells e. Not treating the patient with GM-CSF Answer- ABO-mismatched donor cells Administration of GM-CSF after AuBMT enhances myeloid and platelet recovery and is cost effective in the treatment of patients with relapsed Hodgkin's disease who received intensive chemotherapy and AuBMT A high CD34+ cell dose is associated with improved leukemia-free survival in recipients of HLA-identical bone marrow or peripheral blood stem cells The process of somatic hypermutation leads to ... a. Greater polymorphism of HLA class I b. Greater polymorphism of HLA class II c. Greater affinity of IgG molecules d. Inactivation of the T cell receptor e. Teenage mutant Ninja turtles Answer- Greater affinity of IgG molecules An immunosuppressive agent that binds to the same molecular target as CsA is a. OKT3 b. Prograft (FK506) c. CellCept (Mycophenolate) d. Imuran (azathioprine) e. Prednisone (steroids) Answer- Prograft (FK506) DR51, DR52 and DR53, respectively, are gene products of a DRA and a. DRB3, DRB4, DRB5 b. DRB1, DRB4, DRB5 c. DRB5, DRB4, DRB3 d. DRB1, DRB3, DRB4 e. DRB5, DRB3, DRB4 Answer- DRB5, DRB3, DRB4 All of the following techniques are useful in distinguishing autoantibodies from high PRA alloantibodies except a. Platelet absorption b. NIH-CDC analysis on frozen cell trays c. DTT treatment d. Flow cytometry e. Autocrossmatch Answer- *NIH*-CDC analysis on frozen cell trays (Tracy highlighted NIH) The number of MHC-Class I and II loci... a. Is the same for all humans b. Has been constant throughout evolutionary history c. Is relatively constant, but many new alleles arise by translocation every year d. Varies with the haplotype e. Is the same for all primates Answer- Varies with the haplotype The T cell receptor delivers an intracellular activation signal primarily via which accessory molecule? a. CD3 b. CD2 c. CD4 d. CD8 e. CD28 Answer- CD3 The T cell receptor detects an MHC Class I molecule with the help of which accessory molecule? a. CD3 b. CD2 c. CD4 d. CD8 e. CD28 Answer- CD8 Acute rejection is thought to be mediated primarily by ... a. T cells b. B cells c. Platelets d. Antibodies e. Cytokines Answer- T cells - first 6 months after transplantation likely single explanation? a) Maternal blood present in cord blood sample b) Contamination of pre-PCR area with PCR amplicons c) Low temperature in high stringency wash d) New allele(s) detected e) DNA mixed with another sample Answer- New allele(s) detected A sample with a new HLA-B allele arrives in the laboratory. It has a point mutation in a region of exon 3 that had previously been considered monomorphic. What technique would be most likely to detect the new allele? a) PCR-SSP b) PCR-SSOP c) SBT d) RFLP e) Anomalous linkage disequilibrium with HLA-Cw Answer- SBT A bone marrow patient is A1,A11,B62,B64,DRB1*0103,DRB1*150101. Which of the following potential donors is the best match? a) A1,Blank,B62,B64,DRB1*0103,DRB1*1503 b) A1,A11,B7,B8,DR5,DR6 c) A1,A11,B*1401,B*15,DRB1*0103,DRB1*1501 d) A1,A9,B14,B15,DR1,DR15 e) A1,A11,B14,B15,DRB1*0102,DRB1*1502 Answer- A1,A11,B*1401,B*15,DRB1*0103,DRB1*1501 Which of the listed probes will have the highest Tm? a) AACTAGTTA b) CTATGGATCGTTGGCTACTCT c) GTAGATTATATTACTCTAGCA d) AACTAGTTC e) ATATATATAT Answer- CTATGGATCGTTGGCTACTCT Primers and probes bind to their DNA targets through a process known as a) High stringency b) Hydrogen bonding c) Covalent bonding d) Primer dimerism e) Low Stringency Answer- Hydrogen bonding Which is true of the 3' and/or 5' ends of an oligonucleotide primer? a) The 3' and 5' ends always have purines b) The 3' and 5' ends always have pyrimidines c) The 3' and 5' ends may both serve as an template for Taq elongation d) The 3' end may accept GTP in the presence of a DNA polymerase e) The 5' end is the critical portion for determining the specificity of a primer Answer- The 3' end may accept GTP in the presence of a DNA polymerase Which of the following is true regarding the DNA polymerase used in PCR? a) The enzyme should only accept nucleotide diphosphates b) The enzyme should have low fidelity c) The enzyme should denature at 37oC d) Isomerase enzymes should be able to switch strands e) The enzyme should not be heat labile Answer- The enzyme should not be heat labile Which of the following activities should be performed post-PCR? a) Amplification, probing, high stringency wash b) DNA extraction, low stringency wash, probing c) Gel electrophoresis, probing, primer aliquotting d) Amplification, probing, primer aliquotting e) DNA extraction, high stringency wash, primer synthesis Answer- Amplification, probing, high stringency wash Which statement best explains the "N" suffix sometimes seen with DNA HLA allele nomenclature? a) Some alleles are not typeable by molecular methods b) Some alleles are not typeable by serological methods c) Serology and DNA sometimes arrive at different typings d) Mutations may prevent an HLA allele from being expressed e) Suffixes in molecular nomenclature distinguish class II from Class III alleles Answer- Mutations may prevent an HLA allele from being expressed SSP primers usually target what? a) IgG Fc regions b) Hypervariable regions c) Unique intronic sequences d) Conserved regions e) Sequences in DRB1 exon 1 Answer- Hypervariable regions High resolution Class I and Class II typing is most important in which of the following situations? a) Living-related kidney transplantation with high PRA b) ABO-mismatched liver transplant c) Unrelated bone marrow transplantation d) Autologous bone marrow transplantation e) Two haplotype matched living related bone marrow transplantation Answer- Unrelated bone marrow transplantation Which of the following is an ASHI requirement for PCR amplification setup? a) Dedicated pipetters b) Different color lab coats for pre- and post-PCR c) Phenol/chloroform DNA extraction d) Two independent interpretations of raw data e) Wipe test performed alongside every amplification setup Answer- Dedicated pipetters Which of the following is the preferred sample for DNA extraction? a) Whole blood without anticoagulants b) Red blood cells c) Heparinized serum d) The distal ends of hair e) Whole blood with ACD anticoagulant Answer- Whole blood with ACD anticoagulant Which is not a proper method for minimizing PCR contamination? a) Frequent cleaning of pre-PCR areas with 10% bleach b) Aliquotting reagents into single-use aliquots c) Combining pre-PCR and post-PCR into the smallest practical space d) UV irradiation of pre-PCR areas e) Use of aerosol barrier pipet tips on pre-PCR pipetters f) Use of dUTP in PCR and the enzyme UNG on samples Answer- Combining pre- PCR and post-PCR into the smallest practical space A sample typed by SSP in 1996 was determined to be DRB1*0101,DRB1*0401. When the same sample was retyped in 1998 by SSP the typing was DRB1*0101,DRB1*04(01,34). What is the best explanation of these results? a) New alleles sometimes have the same primer reactivity patterns as old alleles b) Long term DNA storage at -80oC affects primer reactivity c) IUB codes require reinterpretation with time d) As new DQB1 alleles are discovered the DRB1 typings should be revised for unusual linkages e) DRB1*0434 was thought to be a rare allele in 1996 but by 1998 was appreciated as a common allele Answer- New alleles sometimes have the same primer reactivity patterns as old alleles An HLA laboratory's DNA typing report lists 0101,1101 as the final result. What is wrong with this report? a) 0101,1101 is an impossible combination for any HLA locus b) It is wrong to report results for only one HLA locus c) The HLA locus was not defined d) 1101 should always be reported as 110101 e) 0101,1101 should be written as 0101/1101 Answer- The HLA locus was not defined ASHI has detailed and mandatory QC requirements for which of the following in a molecular typing laboratory? a) Water bath cycle speeds b) Thermal cycler block temperature measurements c) Electrophoresis current variations d) Taq polymerase pH dependency e) F-stop and exposure settings Answer- Thermal cycler block temperature measurements Which statement accurately describes the PCR process? b) Is the same for Class I and Class II c) Completely hides the bound peptide d) A,B, & C e) None of the above Answer- None of the above Codon 10, position 2 of a sequence equivalent to what nucleotide position (assume that numbering start at the same position)? a) 10 b) 20 c) 25 d) 29 e) 32 Answer- 29 A typical thermal cycler program for clinical HLA typing has a) 1 PCR cycle b) 5 PCR cycles c) 10 PCR cycles d) 30 PCR cycles e) 60 PCR cycles Answer- 30 PCR cycles A PCR reaction is setup against exon 2 of an HLA gene. A 5' primer binding to nucleotides 10-25 and a 3' primer binding to nucleotides 105-90 are used. Assuming a successful amplification what is the size of the PCR product? a) 105bp b) 96bp c) 65bp d) 66bp e) 25bp Answer- 96bp Standard nucleic acid purine bases are a) C,U,T b) A,B,Cw c) DR,DQ,DP d) C,T e) A,G Answer- purine = A/G pyrimadine = C/T Features of DNA Include... a) Anti-parallel strands b) External bases and Internal phosphate backbone c) Nuclear location in cells d) A, B only e) A, C only Answer- A, C only Which of the following samples would be unacceptable for HLA phenotyping by serology? a. Blood collected in sodium heparin b. Blood collected in CPDA-1 c. Blood collected in ACD solution A d. Blood collected in ACD solution B e. Blood collected in EDTA Answer- Blood collected in EDTA Which sample is the best for molecular testing for class II HLA antigens? a. 5ml Ficoll separated PBL's (1x105 cells/ml) in PBS b. 3ml EBV transformed B cells (1x105 cells/ml) in PBS c. 2 ml peripheral blood in EDTA d. 2 ml peripheral blood in ACD solution B Answer- 2 ml peripheral blood in EDTA You receive a requisition form with today's date and only 4 ml of blood in ACD solution A and 3 ml of blood in a plain red top for HLA class I and II phenotyping and PRA from a 2 year old patient labeled with the patient's first name and last name; what step(s) do you take next? a. Reject it due to improper blood tube additive; notify physician b. Reject it due to improper labeling; notify physician c. Notify the requesting physician the sample quantity is insufficient; request additional blood for testing d. Notify the requesting physician the sample is improperly labeled; request the sample to be re-collected e. Notify the requesting physician the sample volume is acceptable; verify date of collection Answer- Reject it due to improper labeling; notify physician ASHI standards state the minimum sample labeling requirements include(s) unique... a. Identifier b. Identifier and date of collection c. Identifier, date and time of collection d. Identifier, date and time of collection, phlebotomist's initials e. Identifier, date and time of collection, phlebotomist's initials, sample source Answer- Identifier and date of collection Which of the sample sources below yields the greatest number of B cells? a. Whole blood b. Thymus c. Spleen d. Lymph node Answer- Spleen Which of the following samples for CDC PRA should be rejected? a. Plain red top tube b. Serum separator tube c. Frozen serum aliquot d. ACD yellow top tube Answer- ACD yellow top tube Given an adult bone marrow transplant patient's WBC is 5.0x103 cells/l with 20% lymphs and 2,000 lymphocytes/well are required for a class I typing on two 72-well trays, what is the minimum blood volume needed for testing? a. 20 ml b. 10 ml c. 5 ml d. 2 ml Answer- 2 ml T/F Section (only included Tracy highlighted ones) 1 - EDTA is preferred over ACD as an additive for Molecular testing 2 - EDTA chelates calcium and is acceptable for CDC assays 3 - Heparin does not interfere with Taq polymerase 4 - ACD tubes maintain cell viability are better than heparin during long transit times Answer- 1 - T 2 - F 3 - F 4 - T When planning to start up a new lab, in what order should you do the following? 1. Secure adequate work space 2. Hire all personnel 3. Obtain accreditation 4. Determine necessary services Answer- 4,1,2,3 Maslow's hierarchy of needs indicates for individuals whose basic needs for food and shelter are met, the next need is a. Esteem b. Social c. Self-actualization d. Safety e. None of the above Answer- Safety Which of the following is not part of a quality assurance program? a. Checking freezer temperature daily b. Annual competency evaluation c. Monitoring turn-around time d. Bloodborne pathogen safety training e. None of the above Answer- Checking freezer temperature daily Examples of variable costs include which of the following? a. Typing trays, test tubes, salaries b. Pipets, space rental, Taq polymerase c. Call-back pay, complement, magnetic beads d. Gloves, RPMI, utilities Answer- Call-back pay, complement, magnetic beads If the chi-square for the association of B7 with DRB1*0701-DRB4*0103102N is 48. What conclusion is valid based on this statistic? a. The presence of B7 has no predictive value is evaluating the likelihood of the DRB4 null allele d. Usually occurs within 5-10 days of stimulation Answer- Usually occurs within 5-10 days of stimulation A T cell crossmatch is positive by AHG-CDC but negative by flow crossmatch. The most likely explanation is the anti-donor antibody is... a. IgM b. IgG c. Very low titer d. Against a non-HLA target Answer- IgM *CDC and AGH-CDC detect IgM; flow does not* Which of the following is false concerning shipping blood for HLA typing (as of 2002)? a. Shipping is regulated by the DOT and IATA b. Specimens must be packed in a 3 container system c. There must be sufficient absorbent material to soak up a spill d. Blood specimens known to carry pathogens are packaged the same as routine diagnostic specimens Answer- Blood specimens known to carry pathogens are packaged the same as routine diagnostic specimens What is the usual minimum set of family members required to assign the "a" and "c" patient haplotypes? a. Patient and Uncle b. Patient and one sibling c. Patient and mom d. Two siblings of the patient Answer- Patient and mom DRB1*0102 is in strong linkage disequilibrium with DQB1*0501. You class II type a sample as DRB1*010202, DRB1*0301, DQB1*0201, DQB1*0302. Which of the following could not explain the results? a. The sample is from an isolated South American population. This population may have different linkage disequilibria than published values b. Linkage disequilibria are not absolute and exceptions to common linkages are sometimes seen c. The DRB1*01022 variant may have different linkage disequilibria than the more common DRB1*01021 d. In the presence of DRB1*0301 the DRB1*0102 may have a linkage to DQB1*0302 Answer- In the presence of DRB1*0301 the DRB1*0102 may have a linkage to DQB1*0302 You are given a table of allele frequencies published in 1998 without any additional explanatory material. What should be your paramount questions? a. Was the method used SSP or SSOP? Did they type adults or children? b. How many samples were typed? From what population(s) were the samples drawn? c. Was the method used SSP or SSOP? From what population(s) were the samples drawn? d. How many samples were typed? Did they type adults or children? Answer- How many samples were typed? From what population(s) were the samples drawn? A PCR-RFLP assay is performed on DNA amplified from exon 2 of the HLA-DRB1 gene. The restriction enzyme chosen recognizes a single site contained in DRB1*0701 but in no other DRB1 allele. In a patient with the HLA type DRB1*0101/DRB1*0701 how many bands would be expected to appear in the RFLP gel analysis? a. One b. Two c. Three d. Four Answer- Three Linkage disequilibrium between HLA loci is correlated with... a. Physical distance between loci on chromosome 6 b. Order of discovery of the loci c. ABO d. Sex Answer- Physical distance between loci on chromosome 6 Imagine a world in which HLA class I alleles were on chromosome 6 but HLA class II alleles were on chromosome 7. Which potential consequence is least likely? a. Class II would now assume more importance in matching for bone marrow transplantation b. Family studies and haplotype assignments would now have to consider class I and class II independently c. Linkage disequilibrium between class I and class II alleles would decrease d. Crossover events between class I and class II loci would be observed less frequently Answer- Class II would now assume more importance in matching for bone marrow transplantation HLA typing has value in parentage testing because a. HLA loci are few in number b. HLA alleles are few in number c. The polymorphism of HLA alleles is high d. HLA alleles do not exhibit classical Mendelian segregation Answer- The polymorphism of HLA alleles is high Which change would increase Relative Risk for disease Y with HLA allele X? a. Fewer patients with the disease Y observed in the sampled population b. Fewer total individuals with HLA type X in the sampled population c. Fewer controls with HLA type X in the sampled population d. Fewer patients with disease Y but without HLA type X in the sampled population Answer- Fewer controls with HLA type X in the sampled population Which is an example of the deductive reasoning process? a. Using Hardy-Weinberg calculations as evidence for admixture in a specific population b. Gathering statistics on various populations to formulate rules governing population behavior c. Collating statistics on allele frequencies d. Reviewing the literature to find studies to support a specific hypothesis Answer- Using Hardy-Weinberg calculations as evidence for admixture in a specific population Which of the following statements is true regarding molality, molarity, and normality? a. Molarity is the same thing as molality when using hexane as a solvent b. Normality is the same thing as molality for acid but not bases c. In a solution of glucose, C6H12O6, normality has the same value as molarity d. In a solution of sulfuric acid, H2SO4, normality has the same value as molarity Answer- In a solution of glucose, C6H12O6, normality has the same value as molarity Pure water is critical in many laboratory applications. Type I water is defined as having a high purity because it has a ______ of 10.0 a. clarity b. surface Tension c. resistivity d. pH Answer- resistivity New crossmatch assay "X" was evaluated in your laboratory. 100 cell-sera combinations were chosen and then tested using AHG-CDC and assay "X". AHG-CDC identified 50 positive crossmatches. Assay "X" reported 3 positive crossmatches that were negative by AHG-CDC. Assay "X" reported 17 negative crossmatches that were positive by CDC. All other results were the same. What is the concordance between these assays? a. 51% b. 17% c. 3% d. 80% Answer- 80% TP+TN/N Using the data from question #123, and assuming that AHG-CDC is the gold standard, what is the sensitivity of assay "X"? a. 17% b. 66% Due to water bath failure, the stringent wash step of an SSOP assay occurred at 5oC higher than planned. The likely consequence of this deviation is... a. The autoradiograph spots will be more intense than normal b. There might be false positive reactions c. There might be false negative reactions d. No effect on the assay as long as the non-stringent washes are carried out correctly Answer- There might be false negative reactions Tris-EDTA buffer, pH 8.0, is the recommended buffer for long-term storage of DNA, especially at 4oC. How does it work? a. The high pH inhibits bacterial growth while the EDTA prevents inhibits nucleases b. The high pH inhibits nucleases while the EDTA inhibits bacterial growth c. The high pH inhibits acid hydrolysis while the EDTA prevents DNA looping d. The high pH inhibits acid hydrolysis while the EDTA prevents inhibits nucleases Answer- The high pH inhibits acid hydrolysis while the EDTA prevents inhibits nucleases A -20oC freezer used for storage of DNA typing reagents is -35oC. Adjusting the temperature controls has no effect. What immediate action should be taken? a. None. The colder the better b. Cold-sensitive reagents should be moved to another -20oC but the remaining reagents are fine in this improved, extra-cold freezer c. Beakers of warm water should be placed on the bottom shelf since warm air rises d. Reagents should be moved to a backup -20oC freezer and service called Answer- Reagents should be moved to a backup -20oC freezer and service called Which of the following statements is FALSE? a. Significant R values increase as N increases b. Significant Chi-Square values increase as N increases c. Chi-square values have a wider numerical range than R values d. R values can be derived directly from Chi-square without access to the raw data Answer- Significant R values increase as N increases Which of the below equivalencies is FALSE? a. B*3501 = B35 b. B*1501 = B77 c. B*1522 = B*3543 d. B*5002 = B45 Answer- B*1501 = B77 Which is false regarding the chi-square statistic? a. The Yates correction should be used, especially with small sample sizes b. Use of chi-square is an example of an inferential statistical method c. The chi-square should only be used when the data is expressed as TN,TP,FN, and FP d. Chi-square becomes unreliable when expected values become small Answer- The chi-square should only be used when the data is expressed as TN,TP,FN, and FP How can granulocytes in the cell preparation interfere with a crossmatch assay? a. They take up staining dyes resulting in false positive results b. They kill lymphocytes resulting in false positive results c. Since live granulocytes do not take up AO they dilute the count of live cells d. Since dead granulocytes do not take up EB they dilute the count of dead cells Answer- They take up staining dyes resulting in false positive results Within the field of histocompatibility, Prozone is a term that refers to... a. Complete cell death during a crossmatch due to excess antibody b. Complete cell death during a crossmatch due to excess complement c. Achieving the correct titer of AHG to avoid false reactions during an AHG-CDC assay d. False negative crossmatch results due to excess antibody Answer- False negative crossmatch results due to excess antibody AHG best enhances the detection of anti-HLA antibodies under the following circumstances during a crossmatch assay? a. Low titer or IgM antibody b. Low titer or IgG4 antibody c. CYNAP or IgM antibody d. Low titer or high-complement binding antibodies Answer- Low titer or IgG4 antibody * multiple AHG molecules bind to each DSAb attached to the donor cells amplifying the total number of Fc receptors available for interaction with complement component which increases the likelihood of complement activation and cell lysis. Formamide and TMAC can be used in what assay for what purpose? a. PCR-SSP: To raise the annealing temperature b. AHG-CDC: To fix the cells c. PCR-SSP: To increase yield d. SSOP: To enhance annealing specificity Answer- SSOP: To enhance annealing specificity The human haploid genome is 3.3x109 base pairs. Assuming a random distribution of bases, what size probe would be expected to have a single target in the haploid genome? a. 6bp b. 10bp c. 16bp d. 26bp Answer- 16bp What are the most probable haplotype assignments for the displayed family? Patient HLA-A 29,31 | B 07,40 | DR 0404,1501 Sib #1 HLA-A 29,31 | B 7,60 | DR 0404,1501 Sib #2 HLA-A 11,29 | B 7,60 | DR 13,15 Sib #3 HLA-A 11 | B 57,60 | 7,13 Answer- a=A29,B7,DR15; b=A11,B57,DR7; c=A31,B60, DR4; d=A11,B60,DR13 What is the probable haplotype assignment for sibling #2 in the above table? Answer- a/d How does ABO-A2 differ from ABO-A1? Answer- The A2 phenotype expresses about one-quarter the A antigen sites as A1 What is a true statement regarding HLA-A20? a. Not a component of the official WHO nomenclature b. Rare in Caucasians c. Representative "null" allele d. Shares many public epitopes with HLA-Bw4 Answer- Not a component of the official WHO nomenclature Per ASHI standards the viability of the negative control well in a serological typing assay should be... a. At least twice the viability of the positive control well b. Greater than 50% c. Greater than 80% d. Greater than 90% Answer- Greater than 80% If there are 4 possible alleles at a locus how many possible genotypes exist? a. 4 b. 8 c. 10 d. 16 Answer- 10 If there are 5 possible alleles at locus A and 6 possible alleles at locus B how many possible A-B haplotypes exist? a. 5 b. 6 c. 22 d. 30 Answer- 30 Based on the below table of CPM's in a one-way MLC, who is the best matched donor or control? Ax Bx Cx Dx Ex Fx Gx A=Patient 508 11384 40,085 595 58,201 81,251 50,183 B=Dad 30,231 211 49,945 49,601 62,939 46,505 44,836 C=Sibling #1 19,355 27,099 405 37,312 54,016 39,811 37,137 D=Sibling #2 308 14,121 31,110 369 63,699 31,487 46,767 E=Control #1 27,538 29,554 53,417 40,115 724 43,893 23,842 F=Control #2 52,536 59,778 63,186 51,086 59,565 1,743 60,997 G=FCP 54,013 67,867 64,099 59,500 64,219 50,698 60,007 Answer- Sibling #2 a. The patient b. Requesting physician c. Hospital billing department d. Hospital researchers Answer- Hospital researchers In what important way are nitrile exam gloves superior to latex exam gloves? a. The do not trigger or sensitize to latex allergies b. They are less expensive c. They are more resistant to all chemicals d. They are available in a more colors and more vivid colors Answer- The do not trigger or sensitize to latex allergies Per CAP standards a laboratory's document control system should... a. Prevent documents from becoming too long b. Ensure that all copies of documents in use are current c. Prevent documents from containing unnecessary and confusing jargon d. Ensure that all SOP's have sections entitled "Materials and Methods" and "References" Answer- Ensure that all copies of documents in use are current The human genetic code is determined by groups of how many nucleotides? a. 2 b. 3 c. 4 d. Variable Answer- 3 The human genetic code is... a. Degenerate b. Deciduous c. Binary d. Polymorphic Answer- Degenerate Which relative is most like to share one or more haplotypes with a patient? a. Second Cousin b. First Cousin c. Parent d. Sibling Answer- Parent If a population is in Hardy-Weinberg Equilibrium what can be said about rare allele "y"? a. "y" is seen in the population only because of a recent influx of newcomers b. "y" will increase in frequency c. "y" will decrease in frequency d. "y" is usually seen in the heterozygous situation Answer- "y" is usually seen in the heterozygous situation The speed of a centrifuge is doubled. What happens to the RCF? a. Doubles b. Stays the same c. Quadruples d. Depends upon the rotor radius Answer- Quadruples Ficoll-Hypaque separates lymphocytes based upon what inherent property? a. Density b. Size c. Adherence ("stickiness") d. Color Answer- Density In the event of a significant laboratory fire, what should be your course of action? a. Hit the alarm, rescue personnel, close the lab door, evacuate b. Close the lab door, hit the alarm, rescue personnel, evacuate c. Call 911, evacuate d. Rescue personnel, hit the alarm, close the lab door, evacuate Answer- Rescue personnel, hit the alarm, close the lab door, evacuate Liquid nitrogen presents what danger(s) to personnel? a. Toxicity, suffocation b. Frost bite, suffocation c. Flammability, toxicity d. Very low LD50, frost bite Answer- Frost bite, suffocation A chemical has an NFPA rating as indicated below. What is an accurate statement of its hazards? Blue 3 Red 1 Yellow 0 Answer- High health hazard, low reactivity and flammability A frame shift at the start of the second exon of an HLA-B gene will most likely produce what effect? a. Conformational change resulting in poor antibody binding b. Premature truncation of the protein product due to a stop codon c. Creation of new public epitopes d. Heterozygous sequencing results that are clear but of shorter length Answer- Premature truncation of the protein product due to a stop codon Given a eucaryotic DNA sequence of length 200b, known to contain an exon of 180bp, how many possible reading frames are there? a. 1 b. 3 c. 6 d. 20 Answer- 6 In a crossmatch between donor and recipient, both the T cell and the DTT-B cell crossmatch are positive at 1:16. What can be said about the recipient anti-donor antibody? a. Expected to be ELISA class II negative b. High levels of IgM auto-antibody c. Low titer IgG and high-titer IgM d. Class I antibody Answer- Class I antibody Reagent X arrives in the lab without an expiration date. What action should you take? a. Develop a written policy that states, "Chemicals with unlisted expiration dates are good for 7 years" b. Use the chemical indefinitely c. Use the chemical until routine clinical assays show obvious degradation d. Obtain manufacturer and HLA lab recommendations and derive an expiration date Answer- Obtain manufacturer and HLA lab recommendations and derive an expiration date What approach is even better than the correct answer to 182? a. Read over the ASHI manual and find published expiration guidelines b. Buy two bottles of the chemical. Store one, as recommended, at 4C and the other at RT. When the RT one goes bad you know the 4C is also bad c. Periodically QC the reagent and develop a QA analysis of its performance d. Employ Google on a monthly schedule to look for reports of adverse outcomes using older lots of the reagent Answer- Periodically QC the reagent and develop a QA analysis of its performance A supervisor notices that a previously meticulous worker has been making an inordinate number of mistakes in clinical assays. What approach should the supervisor take? a. Use the power of peer pressure by emailing defamatory reports on the employee to co-workers b. Meet with the worker, investigate the problems, and develop a corrective plan c. File a secret memo in the worker's personnel file so as to not embarrass them d. Be extra nice to the employee on the theory that honey catches more flies than vinegar Answer- Meet with the worker, investigate the problems, and develop a corrective plan The products of the KIR gene system are... a. Non-Polymorphic b. Homologous to the HLA antigens c. Detect self through HLA class I d. Detect HLA-DRB4 null alleles Answer- Detect self through HLA class I In a typical HLA laboratory, what would be the order of total annual costs from greatest to least? a. Amortized equipment>supplies>reagents b. Reagents>supplies>salaries c. Salaries>reagents>amortized equipment d. Reagents>amortized equipment>salaries Answer- Salaries>reagents>amortized equipment The absolute A260 and A280 values and their ratio for a DNA sample provide what information? a. Length and concentration b. Four c. Two operationally monospecific antisera or monoclonal antibodies or at least three partially nonoverlapping multispecific antisera or monoclonal antibodies. d. At least three operationally monospecific sera for common antigens and two operationally monospecific sera for rare antigens Answer- Two operationally monospecific antisera or monoclonal antibodies or at least three partially nonoverlapping multispecific antisera or monoclonal antibodies. A colleague sends you a potentially novel allele. Which HLA typing technology provides the most predictable (not "better" but predictable!) results for this allele? a. Serology b. SSCP c. ARMS SSP d. SBT Answer- SBT What is true regarding dUTP? a. DNA nucleotide b. Similar to dCTP in base-pairing c. RNA sugar d. dUTP can be substituted for dTTP in PCR Answer- dUTP can be substituted for dTTP in PCR What is the effect of heterophile antibodies in rabbit complement in the AHG-CDC assay? a. Rabbit complement does not contain appreciable amounts of heterophile antibodies b. Enhances the effectiveness of the complement c. Blocks complement inhibitors in human serum d. Blocks non-specific CYNAP antibodies Answer- Enhances the effectiveness of the complement Human serum accidentally contaminates the AHG stock solution. What is the expected effect in the AHH-CDC assay? a. No effect b. Decreased specificity and many false positive reactions c. Many false negative reactions d. Decreased CYNAP effect Answer- Many false negative reactions Which is a valid separation technology? a. T cells via surface IgM binding to magnetic beads b. Macrophages via uptake of iron filings c. B cells via CD8 binding to magnetic beads d. Neutrophils via segregation into the buffy coat layer of a standard ficoll-hypaque gradient Answer- Macrophages via uptake of iron filings Which of the following would substantially (and always) interfere with a 3-color flow crossmatch? a. Patient undergoing treatment with IVIg b. Patient undergoing treatment with anti-CD20 monoclonal antibody c. Patient has leukemia d. Patient previously had solid organ transplant and is now preparing for stem cell transplant Answer- Patient undergoing treatment with anti-CD20 monoclonal antibody An AML patient in blast crisis types heterozygous for HLA-A,B by serology but homozygous by molecular SBT. The molecular and serological typings both started from freshly drawn ACD tubes and both typings meet all interpretive criteria without apparent anomaly. Which explanation best explains the data? a. Patient received a recent transfusion b. Patient has deranged lymphocytes that express extra HLA's c. Patient has recently received anti-proliferative chemotherapy d. Patient's AML cells differ from patient's lymphocytes in HLA expression Answer- Patient's AML cells differ from patient's lymphocytes in HLA expression