General Biology 1 - DepEd, Exercises of Environmental science

Download General Biology 1 - DepEd and more Exercises Environmental science in PDF only on Docsity! Teaching Guide for Senior High School GENERAL BIOLOGY 1 SPECIALIZED SUBJECT | ACADEMIC-STEM This Teaching Guide was collaboratively developed and reviewed by educators from public and private schools, colleges, and universities. We encourage teachers and other education stakeholders to email their feedback, comments, and recommendations to the Commission on Higher Education, K to 12 Transition Program Management Unit - Senior High School Support Team at k12@ched.gov.ph. We value your feedback and recommendations. The Commission on Higher Education in collaboration with the Philippine Normal University This Teaching Guide by the Commission on Higher Education is licensed under a Creative Commons Attribution- NonCommercial-ShareAlike 4.0 International License. This means you are free to: Share — copy and redistribute the material in any medium or format Adapt — remix, transform, and build upon the material. The licensor, CHED, cannot revoke these freedoms as long as you follow the license terms. However, under the following terms: Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use. NonCommercial — You may not use the material for commercial purposes. ShareAlike — If you remix, transform, or build upon the material, you must distribute your contributions under the same license as the original. Published by the Commission on Higher Education, 2016 Chairperson: Patricia B. Licuanan, Ph.D. Commission on Higher Education
 K to 12 Transition Program Management Unit
 Office Address: 4th Floor, Commission on Higher Education, C.P. Garcia Ave., Diliman, Quezon City
 Telefax: (02) 441-0927 / E-mail Address: k12@ched.gov.ph Development Team Team Leaders: Florencia G. Claveria, Ph.D., Dawn T. Crisologo Writers: Doreen D. Domingo, Ph.D., Aileen C. dela Cruz, Chuckie Fer A. Calsado, Doreen D. Domingo, Janet S. Estacion, Justin Ray M. Guce, Mary Jane C. Flores, Nolasco H. Sablan Technical Editors: Annalee S. Hadsall, Ph.D. Copy Reader: Caroline H. Pajaron Illustrator: Ma. Daniella Louise F. Borrero Cover Artists: Paolo Kurtis N. Tan, Renan U. Ortiz Senior High School Support Team CHED K to 12 Transition Program Management Unit Program Director: Karol Mark R. Yee Lead for Senior High School Support: Gerson M. Abesamis Lead for Policy Advocacy and Communications: Averill M. Pizarro Course Development Officers: John Carlo P. Fernando, Danie Son D. Gonzalvo Teacher Training Officers: Ma. Theresa C. Carlos, Mylene E. Dones Monitoring and Evaluation Officer: Robert Adrian N. Daulat Administrative Officers: Ma. Leana Paula B. Bato, Kevin Ross D. Nera, Allison A. Danao, Ayhen Loisse B. Dalena Printed in the Philippines by EC-TEC Commercial, No. 32 St. Louis Compound 7, Baesa, Quezon City, ectec_com@yahoo.com Consultants THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL UNIVERSITY.
 University President: Ester B. Ogena, Ph.D.
 VP for Academics: Ma. Antoinette C. Montealegre, Ph.D.
 VP for University Relations & Advancement: Rosemarievic V. Diaz, Ph.D. Ma. Cynthia Rose B. Bautista, Ph.D., CHED
 Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila University
 Carmela C. Oracion, Ph.D., Ateneo de Manila University
 Minella C. Alarcon, Ph.D., CHED Gareth Price, Sheffield Hallam University
 Stuart Bevins, Ph.D., Sheffield Hallam University 2 Biology I is a Science, Technology, Engineering and Mathematics (STEM) Specialized Subject taken in the first half of Grades 11/12. Learners go on a journey geared toward the deeper understanding and appreciation of life processes at the cellular and molecular levels previously introduced in Grades 7-10. They will also apply basic chemistry and physics principles as they examine the transformation of energy in organisms. Implementing this course at the senior high school level is subject to numerous challenges with mastery of content among educators tapped to facilitate learning and a lack of resources to deliver the necessary content and develop skills and attitudes in the learners, being foremost among these. In support of the SHS for SHS framework developed by CHED, these teaching guides were crafted and refined by biologists and biology educators in partnership with educators from focus groups all over the Philippines to provide opportunities to develop the following: 1. Saysay through meaningful, updated, and context-specific content that highlights important points and common misconceptions so that learners can connect to their real- world experiences and future careers; 2. Husay through diverse learning experiences that can be implemented in a resource- poor classroom or makeshift laboratory that tap cognitive, affective, and psychomotor domains are accompanied by field-tested teaching tips that aid in facilitating discovery and development of higher-order thinking skills; and 3. Sarili through flexible and relevant content and performance standards allow learners the freedom to innovate, make their own decisions, and initiate activities to fully develop their academic and personal potential. These ready-to-use guides are helpful to educators new to either the content or biologists new to the experience of teaching Senior High School due to their enriched content presented as lesson plans or guides. Veteran educators may also add ideas from these guides to their repertoire. The Biology Team hopes that this resource may aid in easing the transition of the different stakeholders into the new curriculum as we move towards the constant improvement of Philippine education. About this
 Teaching Guide This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly usable for teachers. It contains classroom activities and pedagogical notes, and is integrated with innovative pedagogies. All of these elements are presented in the following parts: 1. Introduction • Highlight key concepts and identify the essential questions • Show the big picture • Connect and/or review prerequisite knowledge • Clearly communicate learning competencies and objectives • Motivate through applications and connections to real-life 2. Motivation • Give local examples and applications • Engage in a game or movement activity • Provide a hands-on/laboratory activity • Connect to a real-life problem 3. Instruction/Delivery • Give a demonstration/lecture/simulation/hands-on activity • Show step-by-step solutions to sample problems • Give applications of the theory • Connect to a real-life problem if applicable 4. Practice • Discuss worked-out examples • Provide easy-medium-hard questions • Give time for hands-on unguided classroom work and discovery • Use formative assessment to give feedback 5. Enrichment • Provide additional examples and applications • Introduce extensions or generalisations of concepts • Engage in reflection questions • Encourage analysis through higher order thinking prompts 6. Evaluation • Supply a diverse question bank for written work and exercises • Provide alternative formats for student work: written homework, journal, portfolio, group/individual projects, student-directed research project Parts of the
 Teaching Guide 4 As Higher Education Institutions (HEIs) welcome the graduates of the Senior High School program, it is of paramount importance to align Functional Skills set by DepEd with the College Readiness Standards stated by CHED. The DepEd articulated a set of 21st century skills that should be embedded in the SHS curriculum across various subjects and tracks. These skills are desired outcomes that K to 12 graduates should possess in order to proceed to either higher education, employment, entrepreneurship, or middle-level skills development. On the other hand, the Commission declared the College Readiness Standards that consist of the combination of knowledge, skills, and reflective thinking necessary to participate and succeed - without remediation - in entry-level undergraduate courses in college. The alignment of both standards, shown below, is also presented in this Teaching Guide - prepares Senior High School graduates to the revised college curriculum which will initially be implemented by AY 2018-2019. College Readiness Standards Foundational Skills DepEd Functional Skills Produce all forms of texts (written, oral, visual, digital) based on: 1. Solid grounding on Philippine experience and culture; 2. An understanding of the self, community, and nation; 3. Application of critical and creative thinking and doing processes; 4. Competency in formulating ideas/arguments logically, scientifically, and creatively; and 5. Clear appreciation of one’s responsibility as a citizen of a multicultural Philippines and a diverse world; Visual and information literacies, media literacy, critical thinking and problem solving skills, creativity, initiative and self-direction Systematically apply knowledge, understanding, theory, and skills for the development of the self, local, and global communities using prior learning, inquiry, and experimentation Global awareness, scientific and economic literacy, curiosity, critical thinking and problem solving skills, risk taking, flexibility and adaptability, initiative and self-direction Work comfortably with relevant technologies and develop adaptations and innovations for significant use in local and global communities Global awareness, media literacy, technological literacy, creativity, flexibility and adaptability, productivity and accountability Communicate with local and global communities with proficiency, orally, in writing, and through new technologies of communication Global awareness, multicultural literacy, collaboration and interpersonal skills, social and cross-cultural skills, leadership and responsibility Interact meaningfully in a social setting and contribute to the fulfilment of individual and shared goals, respecting the fundamental humanity of all persons and the diversity of groups and communities Media literacy, multicultural literacy, global awareness, collaboration and interpersonal skills, social and cross-cultural skills, leadership and responsibility, ethical, moral, and spiritual values On DepEd Functional Skills and CHED College Readiness Standards K to 12 BASIC EDUCATION CURRICULUM SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013 Page 3 of 4 Content Content Standard Performance Standard Learning Competencies Code 6. differentiate aerobic from anaerobic respiration STEM_BIO11/12 -IIa-j-6 7. explain the major features and sequence the chemical events of cellular respiration STEM_BIO11/12 -IIa-j-7 8. distinguish major features of glycolysis, Krebs cycle, electron transport system, and chemiosmosis STEM_BIO11/12 -IIa-j-8 9. describe reactions that produce and consume ATP STEM_BIO11/12 -IIa-j-9 10. describe the role of oxygen in respiration and describe pathways of electron flow in the absence of oxygen STEM_BIO11/12 -IIa-j-10 11. compute the number of ATPs needed or gained in photosynthesis and respiration STEM_BIO11/12 -IIa-j-11 12. explain the advantages and disadvantages of fermentation and aerobic respiration STEM_BIO11/12 -IIa-j-12 K to 12 BASIC EDUCATION CURRICULUM SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013 Page 4 of 4 Code Book Legend Sample: STEM_BIO11/12-IIa-j-12 LEGEND SAMPLE First Entry Learning Area and Strand/ Subject or Specialization Science, Technology, Engineering and Mathematics STEM_BIO11/12 Grade Level Grade 11 or 12 Uppercase Letter/s Domain/Content/ Component/ Topic General Biology - Roman Numeral *Zero if no specific quarter Quarter Second Quarter II Lowercase Letter/s *Put a hyphen (-) in between letters to indicate more than a specific week Week Weeks one to ten a-j - Arabic Number Competency explain the advantages and disadvantages of fermentation and aerobic respiration 12 General Biology 1 The Cell: Endomembrane System, Mitochondria, Chloroplasts, Cytoskeleton, and Extracellular Components Content Standards The learners demonstrate an understanding of (1) Composition of the endomembrane system; (2) Structure and function of organelles involved in energy transformation; (3) Structure and functions of the cytoskeleton; and, (4) Composition and functions of the extracellular components or matrix. Performance Standards The learners shall be able to construct three-dimensional models of whole cells using indigenous or recyclable materials. The models shall show the following cell parts: (1) Endomembrane System, (2) Mitochondria, and (3) Chloroplast Learning Competencies The learners: (1) explain the postulates of the cell theory (STEM_BIO11/12-1a- c-1); (2) describe the structure and function of major and subcellular organelles (STEM_BIO11/12-Ia-c-2); (3) describe the structural components of the cell membrane (STEM_BIO11/12-Ig-h-11); and (4) relate the structure and composition of the cell membrane to its function (STEM_BIO11/12-Ig-h-12) Specific Learning Outcomes At the end of the unit lesson, the learners shall be able to: • illustrate the structure of the endomembrane system, label its parts, and understand how the system works • illustrate the structure of the mitochondria, label its parts, and understand the importance of the enfolding of the inner mitochondrial membrane • illustrate the structure of the chloroplast, label its parts, and relate these parts to photosynthesis • understand the connection of the endomembrane system to other cell parts such as the lysosomes, peroxisomes, endosomes, and cell membrane • understand how the extracellular components or matrix determine the appearance and function of the tissues 
 60 MINS LESSON OUTLINE Introduction Review on the differences between prokaryotic and eukaryotic cells; submission and discussion of responses to the pre-topic homework assigned before the lecture. 5 Motivation Brief class activity on prokaryotic and eukaryotic cells. 5 Instruction/ Practice Lecture. Board work on cell parts, structure, and function. Examination of cheek cells and Hydrilla cells under a microscope. Class activity on identifying the parts and functions of the endomembrane system. 40 Enrichment Class discussion on cell size and relationship of surface area and volume 5 Evaluation Assessment of learners’ knowledge; assignment of homework for next lecture 5 Materials microscope (slide, cover slip), hand-held lens, work books, methylene blue, plastic spoon/popsicle stick, Hydrilla plansts, colored chalk/white board marker Resources (continued at the end of Teaching Guide) (1) (n.d.). Retrieved from <http://www.phschool.com/science/ biology_place/biocoach/cells/common.html> (2) (n.d.). Retrieved from <http://biology.tutorvista.com/animal-and-plant- (3) (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the- cell-as-a-system/> INSTRUCTION/PRACTICE (30 MINS) 1. Draw the cell membrane on one end of the board. 2. Draw the double membrane of the nucleus (nuclear membrane) on the other end of the board. 3. From the nuclear membrane, draw the reticulated structure of the endoplasmic reticulum. Ask the learners what the two types of endoplasmic reticulum are and their corresponding functions. 4. Draw the ribosomes as separate units. 5. Draw a DNA and an mRNA. Explain that the mRNA is a copy of the DNA that will be sent to the cytoplasm for protein synthesis. 6. Explain to the learners that the mRNA leaves the nucleus and goes to where the ribosomes are located (i.e., mRNA + functional ribosome) 7. Explain the possible ‘pathways’ for protein synthesis (e.g., within the cytosol or the endoplasmic reticulum) 8. Draw the mRNA + functional ribosome on the endoplasmic reticulum. With a lot of these, the endoplasmic reticulum becomes a rough endoplasmic reticulum. 9. Draw the formed polypeptide inside the rough endoplasmic reticulum. Discuss the formation of a cisternae and pinching off as a vesicle. 10. Draw the Golgi Apparatus and then a vesicle from the rough endoplasmic reticulum that travels to the Golgi Apparatus and attaches to the part which is nearest the rough endoplasmic reticulum. 11. Ask the learners what the function of the Golgi Apparatus is. Synthesize their answers and compare the Golgi Apparatus to a factory with an assembly manufacturing line. 12. Draw the polypeptide travelling along the Golgi Apparatus stack; pinching off as a vesicle to travel to the next stack. Repeat the process while increasing the complexity of the polypeptide drawing. 13. On the last stack, explain the ‘pathways’ that the vesicle may follow: become a lysosome through fusion with an endosome (i.e., formed by endocytosis), or travel to the cell membrane, fuse with it, and empty its contents. 14. Present the composition of the endomembrane system and discuss how these parts are connected to each other by structure and by function. 15. Draw the mitochondria and label its parts. Explain the importance of the enfolding (cristae) in increasing the surface area of the inner mitochondrial membrane. Further explain to the class that Teacher tip Use chalk or white board markers with different colors. Explain the structure and function of each cell part as you draw them. Explain to the learners that a more detailed discussion of the structure and functions of the cell membrane, mitochondria, and chloroplast will be given in succeeding lessons. enfolding is a common structural strategy to increase surface area. As an example, you may draw a cross-sectional structure of the small intestine. 16. Draw the chloroplast and label its parts. Explain the function that each part performs in the process of photosynthesis. 17. Discuss the similarities of the mitochondria and chloroplast (e.g., both are involved in energy transformation, both have DNA, high surface area, and double membranes).income accounts and lastly, expenses accounts. 
 
 Group the learners into pairs. Ask one to draw the endomembrane system as he/she explains it to his/her partner. Reshuffle the groupings and repeat until all learners have performed the exercise. ENRICHMENT (30 MINS) Facilitate a class discussion on why cells are generally small in size. Explain the relationship between surface area and volume. EVALUATION (60 MINS Ask questions to the learners. Sample questions can be found in the following electronic resources: • (n.d.). Retrieved from< http://www.proprofs.com/quiz-school/story.php?title=cell-structure-test > • (n.d.). Retrieved from< http://study.com/academy/exam/topic/cell-biology.html> Assign a research assignment on this question: How do environmental toxins like lead and mercury affect the functions of the cell? The assignment shall be submitted one week after this lesson. RESOURCES (CONTINUED): (4) (n.d.). Retrieved from <http://www.schools.manatee.k12.fl.us/072JOCONNOR/celllessonplans/ lesson_plan__cell_structure_and_function.html> (5) (n.d.). Retrieved from <http://www.phschool.com/science/biology_place/biocoach/cells/endo.html> (6) (n.d.). Retrieved from <http://study.com/academy/lesson/the-endomembrane-system-functions- components.html> (7) (n.d.). Retrieved from <http://www.ncbi.nlm.nih.gov/books/NBK26907/> (8) (n.d.). Retrieved from <http://staff.um.edu.mt/acus1/01Compart.pdf> 
 Teacher tip Assignments should be handwritten. This strategy is aimed at ensuring that the learners have read the topic rather than just copying and printing from a source. ASSESSMENT 14 Learning Competency Assessment Tool Exemplary Satisfactory Developing Beginnning The learners shall be able to: 1. describe the structure and function of major and subcellular organelles (STEM_BIO11/12-Ia-c-2) Learner participation (during lecture) Learner was able to answer all the question/s without referring to his/ her notes Learner was able to answer the main question without referring to his/her notes but was not able to answer follow-up question/s Learner was able to answer the questions but he/she referred to his/her notes (1) Learner was not able to answer the question/s (2) Learner read notes of his/her classmate Assignment Learner submitted an assignment beyond the requirements Learner submitted a comprehensive and well- written assignment Learner submitted a well written report but some responses lack details (1) Learner did not submit an assignment (2) Learner submitted a partially-finished assignment The learners shall be able to: 2. describe the structural components of the cell membrane (STEM_BIO11/12-Ig-h-11) Learner participation (during practice) Learner was able to concisely answer all the questions Learner was able to answer the main question without referring to his/her notes but was not able to answer follow-up question/s Learner was able to answer the questions but he/she referred to his/her notes (1) Learner was not able to answer the question/s (2) Learner read notes of his/her classmate Laboratory (Examination of Animal and Plant Cells) Learner submitted drawings that were beyond the requirements Learner submitted drawings that fulfilled the requirements (complete and detailed) Learner submitted drawings that were incomplete (1) Learner was not able to submit drawings (2) Learner’s drawings were haphazardly done The learners shall be able to: 3. relate the structure and composition of the cell membrane to its function (STEM_BIO11/12-Ig-h12) Examination Learner obtained 90% to 100% correct answers in the examination Learner obtained 70% to 89.99% correct answers in the examination Learner obtained 50% to 69.99% correct answers in the examination Learner obtained less that 50% correct answers in the examination Research Assignment Learner submitted a research assignment beyond the requirements Learner submitted a comprehensive and well- written research assignment Learner submitted a well written report but some responses lack details (1) Learner did not submit an assignment (2) Learner submitted a partially-finished assignment Encourage the learners to look at the cell as both a system and subsystem. They should develop an understanding of how the parts of a cell interact with one another and how these parts help to do the ‘work’ of the cell (Source: (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-cell-as- a-system/>) Emphasize to the learners that energy transformation is one of the characteristics of life. This refers to the ability to obtain and use energy. This characterizes the main function of the mitochondria and the chloroplasts. MOTIVATION (5 MINS) Ask the learners how they understand the concept of compartmentalization. Relate the concept to how the cell is compartmentalized into organelles. Compare compartmentalization to the division of a house into a receiving room or sala, kitchen, dining room, comfort rooms, bedrooms, etc. Ask the learners why they think a house is divided into several rooms. A possible response is that partitioning of the house into different parts facilitates the simultaneous occurrence of several activities without interfering with one another. Also, materials needed for each activity can be stored at their specific areas. For example, pots and pans are being stored in the kitchen and not in the bedroom. Beds and pillows are found in the bedroom and not in the toilet/bath. Explain to the learners that the mitochondria and chloroplasts have a small amount of DNA. Although most of the proteins of these organelles are imported from the cytosol and are thus programmed by the nuclear DNA, their DNA programs the synthesis of the proteins made on the organelles’ ribosomes (Source: Campbell et al). Compartmentalization separates the DNA material of the nucleus, mitochondria, and chloroplast. Ask the learners if they have experienced going to a city/municipal hall and if they have observed that the Mayor, Vice-Mayor, and the City/Municipal Administrator have separate offices. You can use other examples such as the University President, VP for Academic Affairs, VP for Finance; Philippine President, Vice President, Senators, etc. Compare the nuclear DNA to the Mayor and the mitochondrial DNA and chloroplast DNA to the Vice 
 Teacher tip Explain to the learner that this is how the cell is able to allow conflicting functions (e.g., synthesis vs breakdown) and several cellular activities to occur simultaneously without interference from each other. Mayor. The Mayor runs the city/municipality but the Vice Mayor also performs functions that are specific to their positions. They need different offices (or compartments) to avoid conflict in their functions. Introduce the concept of surface area-volume ratio/relationship to the learners. Show a fruit to the learners and explain that the outer surface of the fruit is the surface area. Peel the fruit and show them what’s inside, explaining that the inside of the fruit is the volume. Explain to the learners that surface area (SA) and volume (V) do not increase in the same manner. As an object increases in size, its volume increases as the cube of its linear dimensions while surface area increases as the square of its linear dimensions. Example: If the initial starting point is the same: SA = 2; Volume = 2 (Ratio = 1:1) A one-step increase will result to: SA = 22 = 4 while V = 23 = 8 (Ratio = 1:2) INSTRUCTION/DELIVERY (30 MINS) Explain and discuss the nature and functions of the Adenosine Triphosphate (ATP) to the learners. Adenosine Triphosphate (ATP)—It is the major energy currency of the cell that provides the energy for most of the energy-consuming activities of the cell. The ATP regulates many biochemical pathways. Mechanism: When the third phosphate group of ATP is removed by hydrolysis, a substantial amount of free energy is released. ATP + H2O → ADP + Pi where ADP is adenosine diphosphate and Pi is inorganic phosphate Group the learners into pairs. Ask one to draw the endomembrane system as he/she explains it to his/ her partner. Reshuffle the groupings and repeat until all learners have performed the exercise. 
 18 Teacher tip Select a fruit that can be easily peeled like calamansi or dalandan Teacher tip Ask questions to the learners while giving the lecture. If an LCD projector is not available, draw the structure of the mitochondria and chloroplast on the board. Illustration 1: Energy release in Hydrolysis (Source: (n.d.). Retrieved from http://scienceaid.co.uk/biology/biochemistry/atp.html) Illustration 2: Chemical Energy and ATP (Source: (n.d.). Retrieved from http://winklebiology.weebly.com/chemical-energyatp.html) Synthesis of ATP • ADP + Pi → ATP + H2O • requires energy: 7.3 kcal/mole • occurs in the cytosol by glycolysis 
 As mentioned, the mitochondria has two membranes: the outer and inner mitochondrial membranes. • Outer Membrane • fully surrounds the inner membrane, with a small intermembrane space in between • has many protein-based pores that are big enough to allow the passage of ions and molecules as large as a small protein • Inner membrane • has restricted permeability like the plasma membrane • is loaded with proteins involved in electron transport and ATP synthesis • surrounds the mitochondrial matrix, where the citric acid cycle produces the electrons that travel from one protein complex to the next in the inner membrane. At the end of this electron transport chain, the final electron acceptor is oxygen, and this ultimately forms water (H20). At the same time, the electron transport chain produces ATP in a process called oxidative phosphorylation During electron transport, the participating protein complexes push protons from the matrix out to the intermembrane space. This creates a concentration gradient of protons that another protein complex, called ATP synthase, uses to power synthesis of the energy carrier molecule ATP. Figure 4: The Electrochemical Proton Gradient and the ATP Synthase (Source: (n.d.). Retrieved from http://www.nature.com/scitable/topicpage/mitochondria-14053590) Explain and discuss the structure and functions of the Chloroplasts. Chloroplasts—Chloroplasts, which are found in plants and algae, are the sites of photosynthesis. This process converts solar energy to chemical energy by absorbing sunlight and using it to drive the synthesis of organic compounds such as sugars from carbon dioxide and water. The word chloroplast is derived from the Greek word chloros which means ‘green’ and plastes which means ‘the one who forms’. The chloroplasts are cellular organelles of green plants and some eukaryotic organisms. These organelles conduct photosynthesis. They absorb sunlight and convert it into sugar molecules. They also produce free energy stored in the form of ATP and NADPH through photosynthesis. Chloroplasts are double membrane-bound organelles and are the sites of photosynthesis. The 
 22 Teacher tip Lecture on mitochondrial membranes can be accessed at (n.d.). Retrieved from <http://www.nature.com/scitable/ topicpage/mitochondria-14053590>. chloroplast has a system of three membranes: the outer membrane, the inner membrane, and the thylakoid system. The outer and the inner membranes of the chloroplast enclose a semi-gel-like fluid known as the stroma. The stroma makes up much of the volume of the chloroplast. The thylakoid system floats in the stroma.  Structure of the Chloroplast • Outer membrane—This is a semi-porous membrane and is permeable to small molecules and ions which diffuse easily. The outer membrane is not permeable to larger proteins. • Intermembrane Space—This is usually a thin intermembrane space about 10-20 nanometers and is present between the outer and the inner membrane of the chloroplast.  • Inner membrane—The inner membrane of the chloroplast forms a border to the stroma. It regulates passage of materials in and out of the chloroplast. In addition to the regulation activity, fatty acids, lipids and carotenoids are synthesized in the inner chloroplast membrane.   • Stroma—This is an alkaline, aqueous fluid that is protein-rich and is present within the inner membrane of the chloroplast. It is the space outside the thylakoid space. The chloroplast DNA, chloroplast ribosomes, thylakoid system, starch granules, and other proteins are found floating around the stroma. • Thylakoid System
 The thylakoid system is suspended in the stroma. It is a collection of membranous sacks called thylakoids. Thylakoids are small sacks that are interconnected. The membranes of these thylakoids are the sites for the light reactions of the photosynthesis to take place. The chlorophyll is found in the thylakoids. The thylakoids are arranged in stacks known as grana. Each granum contains around 10-20 thylakoids. The word thylakoid is derived from the Greek word thylakos which means 'sack'.  Important protein complexes which carry out the light reaction of photosynthesis are embedded in the membranes of the thylakoids. 
 The Photosystem I and the Photosystem II are 
 Teacher tip If an LCD projector is not available, draw the structure of the chloroplast on the board. Lecture on structure and functions of the chloroplast can be accessed at (n.d.). Retrieved from <http:// biology.tutorvista.com/animal-and-plant- cells/chloroplasts.html>. complexes that harvest light with chlorophyll and carotenoids. They absorb the light energy and use it to energize the electrons. The molecules present in the thylakoid membrane use the electrons that are energized to pump hydrogen ions into the thylakoid space. This decreases the pH and causes it to become acidic in nature. A large protein complex known as the ATP synthase controls the concentration gradient of the hydrogen ions in the thylakoid space to generate ATP energy. The hydrogen ions flow back into the stroma.  Thylakoids are of two types: granal thylakoids and stromal thylakoids. Granal thylakoids are arranged in the grana. These circular discs that are about 300-600 nanometers in diameter. The stromal thylakoids are in contact with the stroma and are in the form of helicoid sheets.  The granal thylakoids contain only Photosystem II protein complex. This allows them to stack tightly and form many granal layers with granal membrane. This structure increases stability and surface area for the capture of light.  The Photosystem I and ATP synthase protein complexes are present in the stroma. These protein complexes act as spacers between the sheets of stromal thylakoids. PRACTICE (10 MINS) Group the learners into pairs. Ask one to draw the mitochondria and label its parts while the other does the same for chloroplast. Once done, the partners exchange tasks (i.e., the learner that drew the mitochondria now does the same for the chloroplast). Reproduce these diagrams without the labels and use these for the class activity. To demonstrate how folding increases surface area, ask the learners to trace the edges of the outer membrane with a thread and measure the length of the thread afterwards. Repeat the same for the inner membrane. Compare the results and discuss how the enfolding of the inner membrane increases surface area through folding. 24 EVALUATION Learning Competency Assessment Tool Exemplary Satisfactory Developing Beginnning The learners shall be able to describe the following: 1. structure and function of major and subcellular organelles (STEM_BIO11/12-Ia- c-2) Learner participation (during lecture) Learner was able to answer all the question/ s without referring to his/her notes Learner was able to answer the main question without referring to his/ her notes but was not able to answer follow-up question/s Learner was able to answer the questions but he/ she referred to his/ her notes (1) Learner was not able to answer the question/s (2) Learner read notes of his/her classmate Assignment Learner submitted an assignment beyond the requirements Learner submitted a comprehensive and well- written assignment Learner submitted a well written report but some responses lack details (1) Learner did not submit an assignment (2) Learner submitted a partially-finished assignment Examination Learner obtained 90% to 100% correct answers in the examination Learner obtained 70% to 89.99% correct answers in the examination Learner obtained 50% to 69.99% correct answers in the examination Learner obtained less that 50% correct answers in the examination Essay Assignment Learner submitted an essay beyond the requirements Learner submitted an essay that was comprehensive and well- written Learner submitted a well-written essay some details are lacking (1) Learner did not submit an essay (2) Learner submitted a partially-finished essay General Biology 1 Structure and Functions of Animal Tissues and Cell Modification Content Standard The learners demonstrate an understanding of animal tissues and cell modification. Performance Standard The learners shall be able to construct a three-dimensional model of the animal tissue by using recyclable or indigenous materials. Learning Competencies The learners: • classify different cell types (plant/animal tissue) and specify the functions of each (STEM_BIO11/12-Ia-c-4) • describe some cell modifications that lead to adaptation to carry out specialized functions (e.g., microvilli, root hair) (STEM_BIO11/12-Ia-c-5) Specific Learning Outcomes At the end of the lesson, the learners shall be able to: • present a five-minute report on how the structures of different animal tissues define their function or show a two-minute infomercial about a disease that is caused by animal tissue malfunction; • provide insights, offer constructive feedback, and note areas of improvement on their classmates’ reports or infomercial 
 28 180 MINS LESSON OUTLINE Introduction Communicating learning objectives to the learners. 5 Motivation Class Activity: Pinoy Henyo Classroom Edition 10 Instruction/ Delivery Review on the Hierarchy of Biological Organisation and PTSF; Lesson on Animal Tissues and on Cell Modfication 95 Practice Class Activity: Reporting on structure and function of animal tissue or showing of infomercial on diseases. 60 Evaluation Class Quiz 10 Materials microscopes, LCD Projector (if available), laptop or computer (if available), manila paper, cartolina, photos, images, or illustrations of different types of tissues, drawing materials (e.g. pens, pencils, paper, color pencils, etc.) Resources (continued at the end of Teaching Guide) (1) Reece JB, U. L., (2010). Campbell Biology 10th. San Francisco (CA). INTRODUCTION (5 MINS) Introduce the following learning objectives by flashing these on the board: • classify different cell types (plant/animal tissue) and specify the functions of each (STEM_BIO11/12- Ia-c-4) • describe some cell modifications that lead to adaptation to carry out specialized functions (e.g., microvilli, root hair) (STEM_BIO11/12-Ia-c-5) Ask the learners to work in pairs and write the learning objectives using their own words. MOTIVATION (10 MINS) PINOY HENYO CLASSROOM EDITION Divide the class into two groups. Explain to the learners that instead of having the typical one-on-one Pinoy Henyo, only one representative from each group shall be asked to go to the front and have the mystery word card on his/her forehead. Only three words shall be allowed from the groups: “Oo”, “Hindi”, or “Pwede”. Violation of the rules of the game (e.g., communicating the mystery word to the guesser) shall merit corresponding penalties or disqualification. Assign three representatives per group to guess the mystery words. Each guesser shall be given one minute and 30 seconds. At the end of the activity, ask one or two learners what they think the learning objectives of the lesson will be. Immediately proceed with the Introduction. Teacher tip For this particular lesson, start with the Motivation first (i.e., class activity on Pinoy Henyo Classroom Edition). After the game, proceed to the Introduction by communicating the learning objectives to the learners. For the part when the learners have to state the learning objectives using their own words, ask the learners to face their seatmates and work in pairs. If the learners are more comfortable in stating the learning objectives in Tagalog or In their local dialect, ask them to do so. Teacher tip Prior to this lesson, assign a reading material or chapter for this topic. This shall aid in the facilitation of the class activity. In choosing the mystery words for the game, do not limit yourself with the four types of animal tissues. You may choose terms that describe the tissue type or even body parts wherein the tissues are located. You may also include diseases that are caused by certain malfunctions on the tissues. Make sure to mention the chosen mystery words in the discussion. This shall help the learners to understand the connection of the game with the lesson. Check how the class behaves during the activity. If the learners get rowdy, you may choose to stop the game. Make sure to warn the learners of the consequences first before the start of the activity. Cells that make up epithelial tissues can have distinct arrangements: • cuboidal—for secretion • simple columnar—brick-shaped cells; for secretion and active absorption • simple squamous—plate-like cells; for exchange of material through diffusion • stratified squamous—multilayered and regenerates quickly; for protection • pseudo-stratified columnar—single layer of cells; may just look stacked because of varying height; for lining of respiratory tract; usually lined with cilia (i.e., a type of cell modification that sweeps the mucus). Figure 1: Epithelial Tissue (Source: Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco (CA):.)
 32 Teacher tip Take note that the part on cell modifications is incorporated in the discussion on the structure of the respective cells that make up the tissue that is being discussed. Give emphasis on the differences on the features of the cells that make up the tissue type. For examples or illustrations of the different types of tissues, it is better to use an animal that is endemic in the Philippines or in your specific region so that the learners can relate more in the discussion. Connective Tissue—These tissues are composed of the following: BLOOD —made up of plasma (i.e., liquid extracellular matrix); contains water, salts, and dissolved proteins; erythrocytes that carry oxygen (RBC), leukocytes for defense (WBC), and platelets for blood clotting. CONNECTIVE TISSUE PROPER (CTP)—made up of loose connective tissue that is found in the skin and fibrous connective tissue that is made up of collagenous fibers found in tendons and ligaments. Adipose tissues are also examples of loose connective tissues that store fats which functions to insulate the body and store energy. CARTILAGE —characterized by collagenous fibers embedded in chondroitin sulfate. Chondrocytes are the cells that secrete collagen and chondroitin sulfate. Cartilage functions as cushion between bones. BONE —mineralized connective tissue made by bone-forming cells called osteoblasts which deposit collagen. The matrix of collagen is combined with calcium, magnesium, and phosphate ions to make the bone hard. Blood vessesl and nerves are found at a central canal surrounded by concentric circles of osteons. Figure 2: Connective Tissue (Source: Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco (CA):.) Muscle Tissue—These tissues are composed of long cells called muscle fibers that allow the body to move voluntary or involuntary. Movement of muscles is a response to signals coming from nerve cells. In vertebrates, these muscles can be categorized into the following: • skeletal—striated; voluntary movements • cardiac—striated with intercalated disk for synchronized heart contraction; involuntary • smooth—not striated; involuntary Figure 3: Muscle Tissue (Source: Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco (CA):.) Nervous Tissue—These tissues are composed of nerve cells called neurons and glial cells that function as support cells. These neurons sense stimuli and transmit electrical signals throughout the animal body. Neurons connect to other neurons to send signals. The dendrite is the part of the neuron that receives impulses from other neurons while the axon is the part where the impulse is transmitted to other neurons. Figure 4: Neurons and Glial Cells (Source: Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco (CA):.)
 INTRODUCTION (5 MINS) Introduce a simplified life cycle of a human being or plant. Let the learners identify the changes throughout the different stages and how these organisms grow and develop. Figure 1: Life Cycle of Man and Higher Plants (Source: (n.d.). Retrieved from http:// www.vcbio.science.ru.nl/en/virtuallessons/cellcycle/postmeio/) MOTIVATION (5 MINS) 1. Play the video on ‘Cell Cycle and Cell Division’. This video can be accessed at http:// www.youtube.com/watch?v=Q6ucKWIIFmg.Divide the class into two groups. 2. Show diagrams of cell division in multicellular or eukaryotic organisms to the class. 38 Teacher tip Explain to the learners that these eukaryotic organisms follow a complex sequence of events by which their cells grow and divide. This sequence of events is known as the Cell Cycle. You can show diagrams or illustrations that demonstrate the growth or increase in the number of organisms. Teacher tip You can download the video prior to this session or if internet connection is available during class, you can just make use of the hyperlink to play the video. To access the video through the hyperlink, simply hold the Control (Ctrl) Key on the keyboard and click on the hyperlink. You should ask the learners thought- provoking questions about the video and relate it to the lesson. INSTRUCTION/DELIVERY (30 MINS) Facilitate a lecture-discussion on the general concepts of cell division. Cell Division—involves the distribution of identical genetic material or DNA to two daughter cells. What is most remarkable is the fidelity with which the DNA is passed along, without dilution or error, from one generation to the next. Cell Division functions in reproduction, growth, and repair. Core Concepts: • All organisms consist of cells and arise from preexisting cells. • Mitosis is the process by which new cells are generated. • Meiosis is the process by which gametes are generated for reproduction. • The Cell Cycle represents all phases in the life of a cell. • DNA replication (S phase) must precede mitosis so that all daughter cells receive the same complement of chromosomes as the parent cell. • The gap phases separate mitosis from S phase. This is the time when molecular signals mediate the switch in cellular activity. • Mitosis involves the separation of copied chromosomes into separate cells. • Unregulated cell division can lead to cancer. • Cell cycle checkpoints normally ensure that DNA replication and mitosis occur only when conditions are favorable and the process is working correctly. • Mutations in genes that encode cell cycle proteins can lead to unregulated growth, resulting in tumor formation and ultimately invasion of cancerous cells to other organs. The Cell Cycle control system is driven by a built-in clock that can be adjusted by external stimuli (i.e., chemical messages). Checkpoint—a critical control point in the Cell Cycle where ‘stop’ and ‘go-ahead’ signals can regulate the cell cycle. • Animal cells have built-in ‘stop’ signals that halt the cell cycles and checkpoints until overridden by ‘go-ahead’ signals. • Three major checkpoints are found in the G1, G2, and M phases of the Cell Cycle. 38 Teacher tip Note the learners’ responses to questions about the video compared to the expected responses. The expected responses are the concepts listed in the Instruction / Delivery part. The G1 Checkpoint—the Restriction Point • The G1 checkpoint ensures that the cell is large enough to divide and that enough nutrients are available to support the resulting daughter cells. • If a cell receives a ‘go-ahead’ signal at the G1 checkpoint, it will usually continue with the Cell Cycle. • If the cell does not receive the ‘go-ahead’ signal, it will exit the Cell Cycle and switch to a non-dividing state called G0. • Most cells in the human body are in the G0 phase. The G2 Checkpoint—ensures that DNA replication in S phase has been successfully completed. The Metaphase Checkpoint—ensures that all of the chromosomes are attached to the mitotic spindle by a kinetochore. Kinase—a protein which activates or deactivates another protein by phosphorylating them. Kinases give the ‘go-ahead’ signals at the G1 and G2 checkpoints. The kinases that drive these checkpoints must themselves be activated. • The activating molecule is a cyclin, a protein that derives its name from its cyclically fluctuating concentration in the cell. Because of this requirement, these kinases are called cyclin-dependent kinases or CDKs. • Cyclins accumulate during the G1, S, and G2 phases of the Cell Cycle. • By the G2 checkpoint, enough cyclin is available to form MPF complexes (aggregations of CDK and cyclin) which initiate mitosis. • MPF functions by phosphorylating key proteins in the mitotic sequence. • Later in mitosis, MPF switches itself off by initiating a process which leads to the destruction of cyclin. • CDK, the non-cyclin part of MPF, persists in the cell as an inactive form until it associates with new cyclin molecules synthesized during the interphase of the next round of the Cell Cycle. Discuss the stages of mitosis and meiosis. Mitosis (apparent division)—is nuclear division; the process by which the nucleus divides to produce two new nuclei. Mitosis results in two daughter cells that are genetically identical to each other and to the parental cell from which they came. Cytokinesis—is the division of the cytoplasm. Both mitosis and cytokinesis last for around one to two hours. Prophase—is the preparatory stage, During prophase, centrioles move toward opposite sides of the nucleus.
 Cytokinesis—The telophase stage of mitosis is accompanied by cytokinesis. The two nuclei are compartmentalized into separate daughter cells and complete the mitotic cell division process. In animal cells, cytokinesis occurs by the formation of a constriction in the middle of the cell until two daughter cells are formed. The constriction is often called cleavage, or cell furrow. However, in most plant cells this constriction is not evident. Instead, a new cell membrane and cell wall are assembled between the two nuclei to form a cell plate. Each side of the cell plate is coated with a cell wall that eventually forms the two progeny cells. Table 1: Comparison of Mitosis and Meiosis (Source: http://courses.washington.edu/bot113/spring/ WebReadings/PdfReadings/TABLE_COMPARING_MITOSIS_AND.pdf) 42 Teacher tip You can show a tabular comparison between mitosis and meiosis to point the significance of the two types of division. Divide the class into two groups and ask them about their opinions on the applications of mitosis and meiosis. The following could be possible responses: Significance of mitosis for sexual reproduction: Mitosis is important for sexual reproduction indirectly. It allows the sexually reproducing organism to grow and develop from a single cell into a sexually mature individual. This allows organisms to continue to reproduce through the generations. Significance of Meiosis and Chromosome Number: Chromosomes are the cell's way of neatly arranging long strands of DNA. Non-sex cells have two sets of chromosomes, one set from each parent. Meiosis makes sex cells with only one set of chromosomes. For example, human cells have 46 chromosomes, with the exception of sperm and eggs, which contain only 23 chromosomes each. When a sperm cell fertilizes an egg, the 23 chromosomes from each sex cell combine to make a zygote, a new cell with 46 chromosomes. The zygote is the first cell in a new individual. Meiosis Mitosis 1. Requires two nuclear divisions 1. Requires one nuclear division 2. Chromosomes synapse and cross over 2. Chromosomes do not synapse nor cross over 3. Centromeres survive Anaphase I 3. Centromeres dissolve in mitotic anaphase 4. Halves chromosome number 4. Preserves chromosome number 5. Produces four daughter nuclei 5. Produces two daughter nuclei 6. Produces daughter cells genetically different from parent and each other 6. Produces daughter cells genetically identical to parent and to each other 7. Used only for sexual reproduction 7. Used for asexual reproduction and growth Table 2: Meiosis compared to Mitosis Facilitate a discussion on disorders and diseases that result from the malfunction of the cell during the cell cycle. Present some diagrams or illustrations on some errors in mitosis and allow the learners to predict possible outcomes, diseases, or disorders that may happen: • incorrect DNA copy (e.g., cancer) • chromosomes are attached to string-like spindles and begin to move to the middle of the cell (e.g., Down Syndrome, Alzheimer’s, and Leukemia) 
 Meiosis I compared to Mitosis Meiosis II compared to Mitosis Meiosis I Mitosis Meiosis II Mitosis Prophase I Prophase Prophase II Prophase Pairing of homologous chromosomes No pairing of chromosomes No pairing of chromosomes No pairing of chromosomes Metaphase I Metaphase Metaphase II Metaphase Bivalents at metaphase plate Duplicated chromosomes at metaphase plate Haploid number of duplicated chromosomes at metaphase plate Diploid number of duplicated chromosomes at metaphase plate Anaphase I Anaphase Anaphase II Anaphase Homologues of each bivalent separate and duplicated chromosomes move to poles Sister chromatids separate, becoming daughter chromosomes that move to the poles Sister chromatids separate, becoming daughter chromosomes that move to the poles Sister chromatids separate becoming daughter chromosomes that move to the poles Telophase I Telophase Telophase II Telophase Two haploid daughter cells not identical to the parent cell Two diploid daughter cells, identical to the parent cell Four haploid daughter cells not genetically identical Two diploid daughter cells, identical to the parent cell Teacher tip Significance of Meiosis for Diversity: One of the benefits of sexual reproduction is the diversity it produces within a population. That variety is a direct product of meiosis. Every sex cell made from meiosis has a unique combination of chromosomes. This means that no two sperm or egg cells are genetically identical. Every fertilization event produces new combinations of traits. This is why siblings share DNA with parents and each other, but are not identical to one another. Teacher tip You may show a video that demonstrates how crossing over and recombination of chromosomes occur. The video can be accessed at http:// highered.mheducation.com/sites/ 9834092339/student_view0/chapter11/ meiosis_with_crossing_over.html.s Other chromosome abnormalities: • arise from errors in meiosis, usually meiosis I; • occur more often during egg formation (90% of the time) than during sperm formation; • become more frequent as a woman ages. • Aneuploidy—is the gain or loss of whole chromosomes. It is the most common chromosome abnormality. It is caused by non-disjunction, the failure of chromosomes to correctly separate: • homologues during meiosis I or • sister chromatids during meiosis II PRACTICE (10 MINS) Facilitate games like Amazing Race, Interphase/Mitosis/Meiosis Puzzle in the class. 1. The Amazing Race follows a series of stations or stages with challenges that the learners have to accomplish. Divide the class into groups after the discussion. The number of groups will depend on the number of stages or phases in the process (i.e., interphase, mitosis, or meiosis). 2. The groups will race to accomplish the tasks in five stations. In each station, the learners will assemble given materials to illustrate stages or phases of events in the specific process (i.e., interphase, mitosis, or meiosis). ENRICHMENT (5 MINS) 1. Instruct the learners to watch additional videos on cell division. 2. Introduce animal and plant gametogenesis to the learners in order for them to appreciate the significance of cell division. 3. Facilitate microscopic examination of onion root tip. EVALUATION (5 MINS) Facilitate the accomplishment of a self-assessment checklist. 44 Teacher tip Encourage the learners to actively participate in the challenge. You may give extra points to those who will finish first. A number of good videos have the stages or phases made into a rap or a song. One such example is the video entitled Cell Division Song Spongebob that can be accessed at http://www.youtube.com/watch? v=9nsRufogdoI. Encourage each group to brainstorm and point out their perceptions of the videos. A video on animal and plant gametogenesis can be accessed at http://csls-text.c.u-tokyo.ac.jp/active/ 12_05.html. INTRODUCTION (30 MINS) 1. Before this lesson, ask the learners to read about the topic on transport of materials across membranes. 2. Introduce the topic by providing the learners with background information. 
 In order for the cell to stay alive, it must meet the characteristics of life which include taking nutrients in and eliminating wastes and other by-products of metabolism. Several mechanisms allow cells to carry out these processes. All of the cell’s activities are in one way or another tied to the membrane that separates its interior from the environment. 3. Ask the learners how they understand and visualize a plasma membrane and what characteristics are essential for it to perform its function. 4. Ask the learners to identify the different mechanisms on how materials are transported in and out of the cell. MOTIVATION (60 MINS) 1. Divide the learners into groups and ask them the following question: “What comes to your mind when you see a 20 year old man who is 7.5 ft. tall and 3.5 ft. tall man of the same age?” Among their respective groups, let the learners discuss the similarities and differences between the two. (Hint: Give students a clue by giving them the giant and pygmy as examples). 2. Ask a representative from each group to report the result of their discussion to the whole class. 3. Before the start of the lesson on diffusion, spray an air freshener in one corner of the room and ask the learners to raise their hands if they have smelled the scent of the spray. 4. Ask the learners what they have observed. Who smelled the scent first? Who are the last ones to smell the scent? How would you explain the phenomenon wherein learners in the same classroom smelled the spray at different times? INSTRUCTION/DELIVERY (120 MINS) 1. Show an illustration of a plasma membrane to the learners. 2. Ask the learners to describe the plasma membrane. 3. Discuss the importance of the plasma membrane and how indispensable it is to the life of the cell. 4. Explain how plasma membranes are arranged in the presence of water. 5. Let the learners enumerate the structures found in a plasma membrane.
 Teacher tip Different responses to the question will be drawn from students. Their responses will depend on what aspect they are looking into. Acknowledge the responses of the learners. Point out and explain that the two men are both abnormal. Their growths are abnormal such that one is too big in size and the other one is too small. Both men have defective membranes. Insufficient amount of growth hormones pass through a pygmy’s body while an excessive amount of growth hormones is released in a giant. 6. Explain to the learners the structure of a phospholipid bilayer.
 
 Phospholipids are the foundation of all known biological membranes. The lipid bilayer forms as a result of the interaction between the nonpolar phospholipid tails, the polar phospholipid heads, and the surrounding water. The nonpolar tails face toward the water. Transmembrane proteins float within the bilayer and serve as channels through which various molecules can pass. 7. Ask the learners to enumerate the different transport mechanisms. 8. Differentiate between diffusion and osmosis. 9. Compare and contrast facilitated diffusion and active transport. 10. Present photos of plant and animal cells immersed in an isotonic, hypotonic, and hypertonic solution. 11. Describe solution and solute movement in and out of the cell under hypertonic, hypotonic, and isotonic conditions. 12. Explain the effects of the different solutions to the cells. Ask which among the three solutions is the best for plants? How about for animals? Explain to the learners the water requirement in plants.
 
 Diffusion is the natural tendency for molecules to move constantly. Their movement is random and is due to the energy found in the individual molecules. Net diffusion occurs when the materials on one side of the membrane have a different concentration than the materials on the other side. 
 Osmosis is a special type of diffusion specifically associated with the movement of water molecules. Many cells are isotonic to the environment to avoid excessive inward and outward movement of water. Other cells must constantly export water from their interior to accommodate the natural inward movement. Most plants are hypertonic with respect to their immediate environment. Osmotic pressure within the cell pushes the cytoplasm against the cell wall and makes a plant cell rigid.
 
 To control the entrance and exit of particular molecules, selective transport of materials is necessary. One simple process is facilitated diffusion that utilizes protein transmembrane channels that are specific to certain molecules. It is a passive process driven by the concentration of molecules both inside and the outside of the membrane. Certain molecules are transported in and out of the cell, independent of concentration. This process requires the expenditure of energy in the form of ATP and is called active transport. 13. Differentiate among endocytosis, phagocytosis, pinocytosis, receptor-mediated endocytosis, and exocytosis.
 
 Large molecules enter the cell by generalized nonselective process known as endocytosis. Phagocytosis is endocytosis of a particulate material while endocytosis of liquid material is called pinocytosis. Exocytosis is the reverse process. Receptor- mediated endocytosis is a complicated mechanism involving the transport of materials via coated vesicles.
 48 PRACTICE (45 MINS) Ask the learners to answer the following practice or guide questions: • What is the difference between diffusion and facilitated diffusion? • How do endocytosis and exocytosis allow movement of materials in and out of the cell? • What solution is best for a plant cell? How about for an animal cell? • Explain the orientation of the phospholipid molecules in the presence of water. ENRICHMENT (45 MINS) Let the learners recognize the effect of a defective membrane in normal body functioning. Ask them to write an essay about the possible effects of a faulty plasma membrane aside from the examples given earlier. Ask the learners to individually submit a concept map about plasma membrane and the different transport mechanisms. EVALUATION (180 MINS) Ask the learners to design and a model of a plasma membrane using recyclable or indigenous materials. Divide the learners into groups and assign different concentrations of salt solution to be used in making salted eggs. Ask the learners to answer the following questions: • Why does putting salt on meat preserve it from bacterial spoilage? • Compare specific transport processes (i.e., diffusion, osmosis, facilitated transport, active transport, endocytosis, and exocytosis) in terms of the following: • concentration gradient • use of channel or carrier protein • use of energy • types or sizes of molecules transported INSTRUCTION/DELIVERY (60 MINS) Structure, function and importance of the plasma membrane 1. Present an illustration of the plasma membrane to the class 2. Ask the learners to describe the plasma membrane. 3. Discuss the importance of the plasma membrane and how indispensable it is to the life of the cell. 4. Explain how plasma membranes are arranged in the presence of water. 5. Let students enumerate structures found in a plasma membrane. 6. Make students understand the structure of a phospholipid bilayer. Plasma membranes—are made up of a phospholipid bilayer in an aqueous environment. Phospholipids are the foundation of all known biological membranes. The lipid bilayer forms as a result of the interaction between the non-polar (hydrophobic or water-fearing) phospholipid tails, the polar (hydrophilic or water-loving) phospholipid heads, and the surrounding water. The nonpolar tails face toward the water. Transmembrane proteins float within the bilayer and serve as channels through which various molecules can pass. They function as ‘identification tags’ on cells which enable the cell to determine if the other cells that it encounters are like itself or not. It also permits cells of the immune system to accept and reject foreign cells such as disease-causing bacteria. Many membrane proteins function as enzymes that speed up reactions in cells. Others act like paste or glue-forming cell junctions where adjacent cells stick together. Membranes also contain cholesterol which reduces the cell’s permeability to substances and make the bilayer stronger. Transport Mechanisms 1. Ask the learners to enumerate the different transport mechanisms. 2. Differentiate between diffusion and osmosis. Teacher tip You can ask the following questions before starting the discussion: Have you realized how crucial the task of a plasma membrane is in maintaining the life of a cell? Have you thought about the ways on how the materials needed by the cell and the wastes it needs to dispose are able to move in and out of the plasma membrane? 52 Molecules and substances move in several ways that fall within two categories: passive transport and active transport. In passive transport, heat energy of the cellular environment provides all of the energy, hence, this is not energy-costly to the cell. Active transport, however, requires the cell to do work, requiring the cell to expend its energy reserves. Diffusion is a type of passive transport described as the natural tendency for molecules to move constantly. Their movement is random and is due to the energy found in the individual molecules. Net diffusion occurs when the materials on one side of the membrane have a different concentration than the materials on the other side. Osmosis is a special type of diffusion specifically associated with the movement of water molecules. A solution with a higher concentration of solutes is said to be hypertonic while a solution with a lower concentration of solutes is hypotonic. Water crosses the membrane until the solute concentrations are equal on both sides. Solutions of equal solution concentration are said to be isotonic. This only occurs when the solute concentration are the same on both sides of the membrane. Compare and contrast facilitated diffusion and active transport. Then present photos of plant and animal cells immersed in an isotonic, hypotonic, and hypertonic solution. In addition, describe a solution and solute movement into and out of the cell under hypertonic, hypotonic and isotonic conditions. Explain the effects of the different solutions to the cells. Ask which among the three solutions is the best for plants? For animals? Let them understand water requirement in plants. Many cells are isotonic to the environment in order to avoid excessive inward and outward movement of water. Other cells must constantly export water from their interior to accommodate the natural inward movement. Most plants are hypertonic with respect to their immediate environment. Osmotic pressure within the cell pushes the cytoplasm against the cell wall and makes a plant cell rigid. Ask the learners the following questions: • How do cells behave in different solutions? • What do you notice about the effect of different solutions to animal and plant cells? • What solution is best for an animal cell? Does this hold true with plant cells? When an animal cell such as red blood cell is immersed in an isotonic solution, the cell gains water at the same rate that it loses it. The cell’s volume remains constant in this situation. What will happen to the red blood cell when immersed in a hypotonic solution which has a lower solute concentration than the cell? The cell gains water, swells, and may eventually burst due to excessive water intake. When placed in a hypertonic solution, an animal cell shrinks and can die due to water loss. Water requirement for plant cells is different due to their rigid cell walls. A plant cell placed in an isotonic solution is flaccid and a plant wilts in this condition. In contrast with animal cells, a plant cell is turgid and healthy in a hypotonic solution. In a hypertonic solution, a plant cell loses water, shrivels, and its plasma membrane detaches from the cell wall. This situation eventually causes death in plant cells. Differentiate diffusion from facilitated diffusion. To control the entrance and exit of particular molecules, selective transport of materials is necessary. One simple process is facilitated diffusion that utilizes protein transmembrane channels that are specific to certain molecules. It is a passive process driven by the concentration of molecules on the inside and the outside of the membrane. Certain molecules are transported in and out of the cell, independent of concentration. This process requires the expenditure of energy in the form of ATP and is called active transport. 
 Differentiate endocytosis, phagocytosis, pinocytosis, receptor-mediated endocytosis, and exocytosis.
 Large molecules enter the cell by generalized non-selective process known as endocytosis. Phagocytosis is endocytosis of a particulate material while pinocytosis is endocytosis of liquid material. In this process, the plasma membrane engulfs the particle or fluid droplet and pinches off a membranous sac or vesicle with a particular fluid inside into the cytoplasm. Exocytosis is the reverse process where a membrane-bound vesicle filled with bulky materials moves to the plasma membrane and fuses with it. In this process, the vehicle’s contents are released out of the cell. Receptor-mediated endocytosis is a complicated mechanism involving the transport of materials through coated vesicles. Cells take up molecules more efficiently in this process due to the receptor proteins on their surfaces. Each receptor protein bears a binding site for a particular molecule. If the right molecule contacts a receptor protein, it attaches to the binding site, forming a pocket and eventually pinching off into the cytoplasm. PRACTICE (30 MINS) Ask the learners to answer the following questions: • Explain the orientation of the phospholipid molecules in the presence of water. • Enumerate the structures found in a plasma membrane and give the function of each.
 54 General Biology 1 Carbohydrates and Lipids: Structures and Functions of Biological Molecules Content Standard The learners demonstrate an understanding of the structures and functions of carbohydrates and lipids and their roles in specific metabolic processes. Performance Standard The learners shall be able to explain the role and significance of carbohydrates and lipids in biological systems. Learning Competencies The learners: • categorize the biological molecule as a carbohydrate or lipid according to their structure and function (STEM_BIO11/12-Ii-j-15) • explain the role of each biological molecule in specific metabolic processes (STEM_BIO11/12-Ii-j-16) • detect the presence of carbohydrates and lipids in food products using simple tests Specific Learning Outcomes At the end of the lesson, the learners shall be able to: • present simple molecular models of carbohydrates and lipids and relate the structure to the roles that these molecules play in biological systems • perform tests for the presence of starch and reducing sugars and lipids on common food products 120 MINS LESSON OUTLINE Introduction Presentation of learning objectives and important terms; Discussion on dehydration reactions and hydrolysis 10 Motivation Relating the lessons to real-life situations; Discussion on food as sources of energy and building blocks 10 Instruction/ Delivery/ Practice Discussion, as a class and among groups, on the structure and importance of carbohydrates and lipids. 60 Enrichment Laboratory activity on testing the presence of carbohydrates and lipids on common food products 20 Evaluation Group activity on making molecular models of carbohydrates and lipids 20 Materials projector, laptop (if available), sample food labels, common food or drink products (e.g. flour, cornstarch, cooking oil, food or drink brought by the learners Resources (1) Reece, J.U. (2011). Campbell Biology, 9th ed. San Francisco, CA: Pearson Benjamin Cummings INTRODUCTION (10 MINS) Communicate learning objectives and important terms Introduce the following learning objectives using any of the suggested protocols (i.e., verbatim, own words, or read-aloud) • I can distinguish a carbohydrate from a lipid given its chemical structure and function. • I can explain the roles played by carbohydrates and lipids in biological systems. • I can detect the presence of carbohydrates and lipids in food products using simple chemical tests. Introduce the list of important terms that learners will encounter in this lesson:
 • macromolecule • polymer • monomer • dehydration reaction • hydrolysis • carbohydrates • monosaccharides • disaccharides • glycosidic linkage • polysaccharide • starch • glycogen • cellulose • chitin • lipids • fat • fatty acid • triacylglycerol • saturated fatty acid • unsaturated fatty acid • trans fat • phospholipids • steroids • cholesterol
 MOTIVATION (10 MINS) 1. Divide the class into groups of three. 2. Distribute sample food or nutrition labels to each group and ask them if they know how to interpret the information written on the food labels. 58 Teacher tip Prominently display the learning objectives and important terms on one side of the classroom and frequently refer to them during the discussion. You may place a check-mark beside a term in the wordlist after defining it so that the learners have an idea of their progress. Each learner can also illustrate or define the term on a sheet of paper which can be tacked beside the list of words. Another way of incorporating lists of important terms is to have the words placed in a blank bingo card grid. Learners can write a short definition or description of the term under the entry in the bingo card to block out a square. This may serve as the learners’ reference guide or method of formative assessment. You may ask the following questions to facilitate the discussion and call on several groups to present in front of the class: •How many servings are in this container? •Would you agree that this is the reasonable amount of food you would consume per serving? How many total food calories (C) are in this container? •How much fat is present in one serving? What kind of fat? What is the importance of consuming fats in our diet? •How much carbohydrates are present in one serving? What kind of carbohydrates? What is the importance of consuming carbohydrates in our diet? •Decide on whether this food sample can be eaten often or sparingly and justify. 3.Recall that human beings, like all animals, are heterotrophs that need to take in energy and organic molecules (carbohydrates, fats, and proteins) from plant and animal matter. 4.Explain to the learners that this lesson will describe the structure of carbohydrates and lipids and explain the role that these biomolecules play in important biological processes. Teacher tip For the food labels, local products that are familiar to the learners will make the best samples. Make sure that the labels have carbohydrates, fats, and fibers in them. If there are no food labels available, you may do an image search and print some sample food labels from the internet. Division into small groups of two or three may facilitate sharing. Only call on two or three groups to present if there is limited time. Expect the responses to vary depending on how realistic the serving sizes are. You can also discuss about how advertisers can influence how people perceive food. Take note that a food calorie is the same as 1 kcal or 1000 calories. A young adult would often need to take 1800-2500C per day depending on their size and level of activity. Responses may include saturated, unsaturated, and trans fats. Explain to the learners that these fats will be discussed in more detail during the lesson. Regarding its importance, expect responses ranging from energy source, insulation, for flavor, for aid in cooking, for heart health, skin health, etc. Possible responses include sugar, fibers, etc. Regarding its importance, responses may include energy source, for aid in regular bowel movement, for provision of building blocks for biosynthesis, etc. Figure 2: Dehydration synthesis of disaccharides from monosaccharide components (Source: https:// bealbio.wikispaces.com/file/view/disaccharides.JPG/364413582/disaccharides.JPG) Longer polysaccharide chains are formed by monomer addition through succeeding dehydration reactions. These reactions can occur in the human liver as carbohydrates are stored as polysaccharides called glycogen or in ground tissues of plants where these are stored as starch. Polysaccharides are broken down into simpler components through the use of water to break covalent bonds and release energy. The process, known as hydrolysis (hydro means water and lysis means split), is the opposite of dehydration reactions and often occurs in the digestive tract during chemical and mechanical digestion. Here, enzymes break bonds within polysaccharides. With the aid of water, one – H group attaches to a monosaccharide while another –OH group attaches to the other. Comprehension question: How many molecules of water are needed to completely hydrolyze a polysaccharide that is one thousand monosaccharides long? 
 62 Teacher tip Use ball and stick models or plastic blocks to demonstrate how dehydration and hydrolysis reactions occur. Simple reusable ones may be constructed from toothpicks or clay or similar materials. If a projector is available, you may also use animations like the ones found at <http:// www.cengage.com/biology/ discipline_content/animations/ reaction_types.swfto> to help in visualization. Correct response: 999 water molecules During the discussion, invite the learners to find different kinds of carbohydrates in their food labels. How are carbohydrates classified? Carbohydrates can be classified into three main categories, according to increasing complexity: • monosaccharides (monos means single and sacchar means sugar) • disaccharides (di means two) • polysaccharides (poly means many) Some notes on their structures and functions are found in the following table: Classification Functions Structure Examples Monosaccharide • major cellular nutrient • often incorporated into more complex carbohydrates • contains a carbonyl group (C=O) and may be classified as an aldose or ketose depending on the position • may have three to seven carbons in the skeleton • may be arranged in a linear form when solid and is converted into a ring form in aqueous solution (α form when H is on top of plane of ring and β form when -OH is on top of plane of ring) • Ribose—a 5C aldose that forms part of the backbone of nucleic acids • Glucose—a 6C aldose that is the product of photosynthesis and the substrate for respiration that provides energy for cellular activities • Fructose—a 6C ketose that is found in many plants and is often bonded to glucose Teacher tip Examples of alpha helices and beta sheets may be created using wire for the backbone and yarn for the H- bonds; invite learners to speculate on why alpha helix structures are associated with storage polysaccharides and beta sheets with structural polysaccharides. Teacher tip Invite learners to compare the rigidity or structural integrity of plant matter or paper, a shrimp’s shell, and a mushroom. Explain that all these structures are formed from β sheets. Classification Functions Structure Examples Disaccharide • energy source • sweetener and dietary component • forms when a glycosidic linkage forms between two monosaccharides • Maltose (glucose + glucose)—malt sugar often found in sprouting grains, malt-based energy drinks, or beer • Lactose (glucose + galactose)—milk sugar that is a source of energy for infants; an enzyme called lactase is required to digest this. Many adult Filipinos have low levels of this enzyme leading to a condition called lactose intolerance. • Sucrose (glucose + fructose)—found in table sugar processed from sugar cane, sweet fruits, and storage roots like carrots Polysaccharide • storage material for important monosaccharides • structural material for the cell or the entire organism • forms when hundreds to thousands of monosaccharides are joined by glycosidic linkages • Storage polysaccharides are large molecules retained in the cell and are insoluble in water (formed from α 1,4 linkage monomers; with a helical structure) 
 o Starch—amylase is unbranched starch forming a helical structure while amylopectin is branched starch, these are present in plant parts like potato tubers, corn, and rice and serve as major sources of energy.
 o Glycogen—found in animals and fungi; often found in liver cells and muscle cells • Structural polysaccharides (formed from β 1,4 linkage of monomers; strands associate to form a sheet-like structure)
 o Cellulose—tough sheet-like structures that make up plant and algal cell walls that may be processed to form paper and paper-based products; humans lack the enzymes to digest β 1,4 linkages so is passed out of the digestive tract and aids in regular bowel movement 
 o Chitin—used for structural support in the walls of fungi and in external skeletons of arthropods
 o Peptidoglycan—used for structural support in bacterial cell walls ENRICHMENT (20 MINS) Divide the class into groups. Instruct the learners to prepare the following materials that are needed for the laboratory activity:
 • eight glass droppers, medicine droppers, or caps • 12 test tubes • test tube holders or tongs • beaker • alcohol lamp • Benedict’s solution • iodine solution • ethanol solution • glucose solution • flour or cornstarch • cooking oil • sample of student- brought food or drink • mortar and pestle
 Explain the following processes to the learners. Benedict’s solution, a blue solution with CuSO4(aq), can detect the presence of reducing sugars (i.e., any sugar with a free aldehyde or ketone group such as all monosaccharides and the disaccharides lactose and maltose). When boiled, these sugars reduce Cu2+ in Benedict’s solution to produce a brick- red precipitate of Cu2O(s). Iodine test can be used to detect the presence of starch. Teacher tip This activity may be done as a class if time does not permit for the activity to be done in separate groups. If Benedict’s solution is not available, you may only perform the last two tests. In the absence of laboratory grade chemicals, you may improvise with store- bought chemicals like iodine and 70% ethyl alcohol for medical use. Make sure to test the procedure before performing the activity in the class. Emulsion test can be used to identify fats. Learners should perform all three tests on the following samples: 
 • glucose solution (available in the baking section of grocery stores) • flour or cornstarch solution • cooking oil • food or drink sample that the learners brought. 
 For solid samples, instruct the learners to mash a small portion of the sample in some water using the mortar and pestle and then test the resulting solution. Ask the learners to prepare a table with appropriate headings in which to record their results. In discussing the results, ask the learners to conclude whether carbohydrates or lipids are present in their samples. They may compare this with the list of ingredients for their food or drink sample. They can also list possible sources of errors. EVALUATION (20 MINS) Divide the class into small groups. Provide the groups with different structures of lipids or carbohydrates and ask them to create models using common or recyclable materials. Ask the learners to explain or write a short description of their models. In grading the models, check to see if the learners were able to create an accurate model of the assigned lipid or carbohydrate. Ask the learners, still in their small groups, to create a short flowchart that will allow them to distinguish between the different kinds of carbohydrates and lipids based on their structures. They may use this flowchart in answering the comprehension questions that follow. Provide different molecular structures of the following and ask the learners to identify whether these are: 
 68 Teacher tip Prior to this lesson, instruct the learners to bring recyclable materials that they can use for this activity. • monosaccharides
 • disaccharides • storage polysaccharides • structural polysaccharides • saturated fats • unsaturated fats • phospholipids • steroids. 
 You may also ask the learners to give one of the associated functions or characteristics of the given carbohydrate or lipid. Teacher tip The various carbohydrate structures were obtained from the following electronic resources: • commons.wikimedia.org • http://www.nature.com/pj/journal/v43/ n12/images/pj201196f3.jpg • http://chemwiki.ucdavis.edu/@api/deki/ files/522/260px-Cellulose_strand.jpg? size=bestfit&width=352&height=310&r evision=1 Images for the various lipid structures were obtained from the following electronic resources: • https://upload.wikimedia.org, • http://www.mikeblaber.org/oldwine/ BCH4053/Lecture13/triglyceride.jpg, https://my.bpcc.edu/content/blgy225/ Biomolecules/phospholipid.gif 6. Discuss the common secondary structures of proteins (i.e., helical and sheet-like structures). 7. Discuss the different helical types (3-10 helices, alpha helices, and pi helices). Show how these different types are based on which residues are bound by hydrogen bonds or how many atoms are included in the helices hydrogen bonding network. 8. Show how some proteins are composed of combinations of the secondary structures in differing ratios. 9. Discuss how the arrangement of the secondary structures in these proteins may lead to the formation of functional regions (e.g., active sites). 10. Discuss how protein functions may involve the interaction of several proteins in what is known as quaternary associations (e.g., protein complexes for signal transduction). PRACTICE (15 MINS) Instruct the learners to construct paper models of helical structures. Paper models may be made to represent structures such as the 3-10 helix and the alpha-helix. This would require the drawing of polypeptide chains on paper, and the folding of the paper ensuring that the peptide bonds are kept planar. The linkage of the appropriate amide protons (NH) with the appropriate C=O group will create models of the proper dimensions (i.e., angle and width). This is based on the classic experiment by Linus Pauling on the discovery of the alpha helix. ENRICHMENT (15 MINS) Prior to this lesson, the learners may generate computerized protein models and bring them to class. Also, software on molecular viewers should be downloaded from the internet. These software, such as the SwissPDB Viewer, can be downloaded for free. Sample protein structures may be downloaded from the Protein Data Bank that can be accessed at www.pdb.org. Determine the surface features of the observed protein (e.g., hydrophobic areas, charged areas). If a protein with an active site and a bound ligand is chosen (eg., PDBID _____),then the location of the active site and the nature of the protein-ligand interaction may be explored. EVALUATION (60 MINS) Conduct an examination to assess the learners’ knowledge and understanding of the discussions. 72 Teacher tip Note that signal transduction pathways commonly involve quaternary protein structures. The maintenance of proper interactions in these structures is necessary to produce the desired functions. Dysfunction in these associations is commonly associated with disease. Some current cancer diagnostic kits target mutations that may disrupt the proper association of proteins in these complexes. Teacher tip A video on the discovery of the alpha helix using paper models is available on the internet. This video features Dr. Linus Pauling himself describing the general steps in creating an alpha helix paper model. Teacher tip Familiarize yourself with the features of the molecular viewer. SwissPDB Viewer allows you to select amino acids of certain types (e.g., hydrophobic residues). Teacher tip These may be colored or labelled to show their positions in the protein. The position of hydrophobic patches and charged surfaces in proteins can signify areas of potential interaction. General Biology 1 Amino Acids and Proteins Pt. 2 of 2 Content Standard The learners demonstrate an understanding of the structures and functions of biological molecules (i.e., carbohydrates, lipids, nucleic acids, and proteins) Performance Standard The learners shall be able to identify key structural features of biological molecules that are important for their functions (e.g., 5’ and 3’ OH of DNA, 2’ OH of RNA, complementary base pairing, N and C termini of proteins, R groups of the different amino acids, etc.). Learning Competencies The learners: • categorize the biological molecules (e.g., DNA, RNA, proteins) according to their structure and function (STEM_BIO11/12- II-j-15) • explain the role of each biological molecule in specific metabolic processes (STEM_BIO11/12 -II-j-16) • explain oxidation/reduction reactions (STEM_BIO11/12- II-j-18) • determine how factors such as pH, temperature, and substrate affect enzyme or protein activity (STEM_BIO11/12 -II-j-19) Specific Learning Outcomes At the end of the lesson, the learners shall be able to: • discuss key structural features of DNA, RNA, and proteins • discuss structural and functional differences between DNA and RNA • discuss the different levels of protein structure (i.e., primary, secondary, tertiary, and quaternary) • discuss how protein structural features may influence their functions
 LESSON OUTLINE Introduction Review on Cell and its organelles; Discussion and illustrations of the Central Dogma of Molecular Biology 5 Motivation Class activity on the important functions of biological molecules` 5 Instruction/ Delivery Lecture-discussion on the main functions and important physical properties of biomolecules 30 Practice Exercise on translating coding to non-coding sequences 5 Enrichment Practice exercise on translating coding sequences into mRNA transcripts and mRNA transcripts into polypeptide sequences. 5 Evaluation Practice exercises on identification of biomolecules based on given chain structures, identification of important structural features in the chain structures, and generating non-coding sequences (DNA), transcripts (RNA) and polypeptides to assess learners’ understanding of the topics 10 Materials recyclable materials for construction of models of biological molecules, software for molecular modelling (available for free download) Resources (1) SwissPDB Viewer software (available for free download) (2) Protein Data Bank (can be accessed at www.db.org 60 MINS INTRODUCTION (5 MINS) 1. Facilitate a review on the cell and its organelles. Emphasize that the specific functions for each organelle type are compartmentalized and that the functions of each organelle are defined by its physical properties. 2. Explain to the learners that the lesson will focus on understanding the important physical properties of certain biomolecules (i.e., DNA, RNA and proteins) and how these properties allow the biomolecules to serve specific functions within the cell. 3. Discuss the Central Dogma of Molecular Biology: DNA RNA Protein MOTIVATION (5 MINS) 1. Divide the class into groups and instruct them to identify or enumerate the most important functions of DNA, RNA, and proteins. 2. Consolidate the learners’ responses on the board. INSTRUCTION/DELIVERY (30 MINS) Elaborate on the main functions of the biomolecules: • DNA—is the repository of genetic information • RNA—serve as the transcripts and regulators of expressed genetic information • Proteins—are the functional products and executors of cellular functions 74 Teacher tip Relate the Central Dogma of Molecular Biology to real world situations. For example, in cooking, the cook book functions like the DNA (Genome). The specific recipe functions like the mRNA while the desired dish is the protein. Provide two more examples of everyday life activities that can illustrate the Central Dogma of Molecular Biology. Teacher tip Note the following expected responses: • DNA—repository of genetic information • RNA—transcripts and regulators of expressed genetic information • protein—functional products and executors of cellular functions Biomolecule Physical Property Functional Relevance DNA Complementary Base Pairs Allows each strand to serve as a template for replication and transcription Phosphodiester bonds Essential for polynucleotide chain elongation Deoxyribose 5’OH Start of the polynucleotide chain Deoxyribose 3’OH “End” of the polynucleotide chain Connection point for extending the chain ENRICHMENT (5 MINS) Convert the given coding sequence into an mRNA transcript: Complementary Non-coding / Template sequence: 3’ TACGTATCTAATCCTATAGGGTCTATC 5’ 2. Translate the given mRNA transcript into a polypeptide sequence: Coding sequence ~ mRNA transcript: 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’ EVALUATION (10 MINS) Ask the learners to identify the type of biomolecule represented by a given chain structure: • DNA • RNA • Protein You may ask the learners to identify the important structural features in these chain structures. The features are listed in Table 1 in the Instruction/ Delivery section of this Teaching Guide. A similar exercise of generating non-coding sequences (DNA), transcripts (RNA), and translated polypeptides may be performed to test the learners’ understanding of the topic. Teacher tip The correct responses are the following: For no. 1, the coding sequence ~ mRNA transcript is 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’ For no. 2, the polypeptide sequence is N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C Note that the mRNA transcript has almost the same sequence as the coding sequence (DNA), but the Thymines are converted to Uracil. Teach the learners how to read the Codon Table. Teach the learners the single letter codes for the amino acids (e.g., Tryptophan Trp W). Instruct the learners to spell their names using the amino acid codes (e.g., N-E-I-L Asn – Glu – Ile – Lue). Teacher tip Worksheets with partially-completed sequences may be used to help the learners practice the generation of complementary sequences. For example: Template sequence 3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’ 5’ _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3’ General Biology 1 Biological Molecules: Enzymes Content Standard The learners demonstrate an understanding of enzymes and of the factors affecting enzyme activity. Performance Standard The learners shall be able to explain the role and significance of enzymes in biological systems. Learning Competencies The learners: • describe the components of an enzyme (STEM_BIO11/12-Ii-j-17) • determine how factors such as pH, temperature, and substrate affect enzyme activity (STEM_BIO11/12-Ii-j-19) Specific Learning Outcomes At the end of the lesson, the learners shall be able to: • present a model demonstrating the components of a specific enzyme in a biological system and the reaction it catalyzes • design a simple experiment that illustrates how pH, temperature, or amount of substrate affect enzyme activity (i.e., includes problem statement, hypothesis, materials and methods) 78 150 MINS LESSON OUTLINE Introduction Presentation of objectives and terms; Brief discussion on thermodynamics or protein structure 5 Motivation Illustration and explanation of enzymatic browning in bananas 5 Instruction/ Delivery/ Practice Small-group and class discussion on definition of enzymes, its structure, and function 60 Enrichment Laboratory activity on the work of enzymes using raw liver as a source of catalase and hydrogen peroxide as the substrate 60 Evaluation Group activities on creating models of enzyme-catalyzed reactions and designing of a simple experiment on enzyme activity 20 Materials projector, computer, recyclable materials for making models of enzyme-catalyzed reactions. Resources (1) Reece, J.U. (2011). Csmpbell Biology, 9th ed. San Francisco, CA: Pearson Benjamin Cummings. INTRODUCTION (5 MINS) Introduce the following learning objectives using any of the suggested protocols (e.g., verbatim, own words, or read-aloud): • I can describe the components of an enzyme. • I can determine how factors such as pH, temperature, and substrate affect enzyme activity. Introduce the list of important terms that the learners will encounter: • enzyme • catalyst • activation energy • substrate • enzyme-substrate complex • active site • induced fit • cofactor • coenzyme • competitive inhibitor • noncompetitive inhibitor MOTIVATION (5 MINS) Connect the lesson to a real-life problem or question. While the learners are coming in and settling down in the classroom, show them that you are cutting a banana into small pieces on a plate. After the introduction, you can show the learners the plate of banana pieces. Instruct them to pass it around and share their observations. The following could be expected answers: • The banana’s covering is brown. • The banana’s texture is mushy. • The banana looks spoiled. • The banana is smelly • The banana is soft. Teacher Tip: Prominently display the learning objectives and important terms prominently on one side of the classroom and frequently refer to them during discussion. You may place a check-mark beside a term in the wordlist after defining it so that the learners have an idea of their progress. Another way of incorporating lists of important terms is to have the words placed in a blank bingo card grid. Learners can write a short definition or description of the term under the entry in the bingo card to block out a square. This may serve as the learners’ reference guide or method of formative assessment. Teacher Tip: You may opt to divide the class into groups of twos or threes to facilitate sharing of observations and insights. You may call on two to three groups to share their observations if there is limited time for presentations. • The reaction shown in Figure 1 is spontaneous but the activation energy provides a barrier that determines the rate of the reaction. Reactants have to absorb enough energy from their environment to surmount this barrier before the reaction can proceed. • Knowing this, how can you cause reactants to absorb more energy from their environment? How do enzymes affect reactions? Heat speeds up reactions. This is inappropriate for biological systems because it denatures proteins, kills cells, and speeds up all reactions, not just those that are needed. Enzymes catalyze specific reactions by lowering the activation energy barrier and allowing the reactant molecules to absorb enough energy at moderate temperatures. Enzymes cannot change the !G for a reaction and can only hasten reactions that would eventually occur anyway. View Part I of the animation at http://www.sumanasinc.com/webcontent/animations/content/enzymes/ enzymes.html. Click on ‘Show Narrative’ to reinforce the aforementioned concepts on spontaneous reactions. Ask the learners to answer the following questions and call on a small group to explain their responses using their own words: • What is the activation energy of a reaction? • How do enzymes affect the activation energy of a reaction? Enzyme structure and function View http://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/ animation__how_enzymes_work.html. Click on ‘Text’. Ask the learners to answer the following question and call on a small group to explain their responses using their own words: On a molecular level, how does the shape of an enzyme enable it to perform its function? Use the following terms in your responses: ‘active site’, ‘substrate’, ‘enzyme-substrate complex’, and ‘product’. The active site and functional groups of its amino acids may lower activation energy by: • acting as a template for substrate orientation • stressing the substrates and stabilizing the transition state • providing a favorable microenvironment • participating directly in the catalytic reaction Teacher tip Relate the discussion with the hypothetical reactions in Figures 1 and 2. 82 View http://www.wiley.com/college/boyer/0470003790/animations/enzyme_binding/ enzyme_binding.htm. Click on ‘Binding Models’. Ask the learners to answer the following questions and call on a small group to explain their responses using their own words: • How does the shape of an enzyme enable it to perform its function? • What is the difference between Emil Fisher’s lock-and-key model and Daniel Koshland’s induced-fit model? Describe the current model. Factors that affect enzyme action Given what the learners know about enzyme action, ask them to predict how the following factors will affect the action of an enzyme by completing the table below. This may be done by group or by the class as a whole. If the entire class is involved, invite a small group to fill in each row. Table 1: Factors that affect enzyme action. View http://moleculesoflife2010.wikispaces.com/file/view/Enzyme+Model.swf and test the hypotheses using controlled simulations. You may need to use a timer to assess reaction rates. Do your results agree with your predictions? How were they similar? How were they different? Provide constructive feedback and clarify the reasons for the observed changes to reaction rates and enzyme function.
 Teacher tip The video links provided here may be given as a pre-lecture assignment to stimulate prior knowledge and give the learners an idea of the topics to be discussed. If a computer is not available, you may ask the learners to answer the questions based on your discussion. Provide constructive feedback and correct misconceptions. You may use models or analogies to better illustrate the concepts. Here are some suggestions: • a handshake to demonstrate induced fit • two pieces of a jigsaw puzzle to illustrate components of a substrate • roleplay to show the interactions between enzymes and substrates Clarify the misconception that enzymes only function in catabolic reactions or breaking down of substances. This misconception may be due to the learners’ first encounter of enzymes in the context of digestion. Enzymes also catalyze other types of reactions. For example, DNA polymerase facilitates the addition of nucleotides to a polynucleotide chain. View http://web.biosci.utexas.edu/psaxena/MicrobiologyAnimations/Animations/Enzyme-Substrate/micro_enzyme-substrate.swf. Ask the learners to answer the following question and call on a small group to explain their response in their own words: What is the difference between a competitive and noncompetitive inhibitor? The presence of non-protein helpers called co-factors and of organic molecules like co-enzymes may activate apoenzymes to produce holoenzymes by binding to their active sites. Common examples may be found in popular supplements such as ions of iron, copper, zinc, or in vitamins like vitamins A, C, and B-complex. Enzyme regulation and metabolic control View http://usmanscience.com/12bio/enzyme/enzyme_animations.htm. Click on ‘Allosteric Enzymes’ and ‘Feedback Inhibition’. Ask the learners to answer the following questions and call on a small group to explain their responses in their own words: What are allosteric enzymes? Feedback inhibition regulates metabolic pathways that use more than one enzyme. How does feedback inhibition work? ENRICHMENT (60 MINS) Facilitate a laboratory activity on investigating the work of enzymes using raw liver as a source of catalase and hydrogen peroxide as the substrate. Learners may be provided with the following: • temperature as a factor: ice water bath, water bath at room temperature, warm water bath • pH as a factor: acid solution, alkaline solution, and litmus paper • amount of substrate: droppers • small test tubes or medicine caps Explain that many living tissues contain catalase or peroxidase that catalyzes the reaction conversion of H2O2 → H2O + O2. Cut the liver into equal-sized cubes and demonstrate the effect of placing the liver in a 2mL solution of hydrogen peroxide. Evolution of gas (i.e., bubbling) will be observed. Groups of learners may prepare solutions that they can test using the different factors. Instruct the learners to rank the different solutions based on the rates of reactions. Teacher tip This activity may be done as a class if there is not enough time to perform the laboratory work individually or in groups. You may perform the test on all three factors or you may choose only one or two. 84 INTRODUCTION (5 MINS) Review with the class that oxidation-reduction (redox) reactions involve electrons passing from one molecule to another. Oxidation (also splitting) is the loss of electrons while reduction is the gain of electrons. You can show this picture to your students and try to ask questions so that you can generate critical-thinking skills from them. To help them visualize the concept, a diagram of redox reactions is also shown below. Ask your students which organisms (in the picture below) photosynthesize and which respire (take note that plants both photosynthesize ad respire at the same time). Then show the equation of redox reactions after your students have given their responses. You may also ask examples of oxidation reactions (e.g., browning of peeled potato, banana, and eggplant). For redox reactions examples are rusting of iron, burning of combustible material (e.g., wood, coal, etc.) NOTE: Energy transformation (e.g., photosynthesis and cellular respiration is one of the difficult topics in biology. To capture the general picture of the topic, students have to be encouraged to read and re- read the key concept, write and re-write, outline and re-outline, draw and re-draw, and to recite orally if they want the ideas to sink in their system. Patience and steadfastness are important virtues that should be included as you study this concept. 
 Teacher Tip: Note: This lesson merely describes the major features of (or an overview) photosynthesis and cellular respiration. A more detailed concept and deeper explanation will be presented in another set of learning competencies. Emphasize that the flow of energy starts with the sun. There are two organelles that participate in the energy flow from the sun through living things. You can now motivate your students by posting two questions relating to energy transformation. Redox reactions is one type of chemical reaction. Emphasize to students the importance of understanding the processes rather than memorizing all the various reactions. Remember that plants both photosynthesize and do on aerobic respiration. The following are some of the practical examples of photosynthesis: 1. Photosynthesis helps create food chains or food web (Note: Most modern scientists prefer the latter because it portrays the accurate interactions of several organisms in the environment. The interactions make possible the production and perpetuations of the living creatures. Most life forms directly or indirectly depend on plants for their basic metabolism. Ultimately, materials from producers, herbivores, omnivores and carnivores will be consumed by decomposers (e.g., bacteria). These bacteria produce waste products that increase the nutrient content of the soil. Countless chemical reactions are occurring in cells to do essential life functions with the help of ATP as the energy currency of the cells. Ask your students what are the tasks of ATP. The following are the answers: 1. Chemical work: ATP is used for building macromolecules 2. Transport work: ATP is used for transporting ions membranes 3. Mechanical work: ATP is used for mechanical processes such as muscle contraction, cilia movement For additional information, tell the class that ATP is also involved in rigor mortis—a temporary stiffness of the body that happens soon after death of a person. MOTIVATION (5 MINS) Post these two questions on the board. Ask them to identify the process involved in each question so that food is manufactured and energy is released. • How do plants harness light energy to manufacture food? • How do living organisms harness energy from food? Then show to them the overall equation for each process as follows: • Chemical reactions for photosynthesis: 6 CO2 + 6 H20 + sunlight C6H12O6 + 6 O2 • Which groups participate in the reaction? 
 88 Thus, plants are able to produce macromolecules (e.g., carbohydrates, proteins, fats and nucleic acids) and sustain other cellular activities because of the participation of the soil, nutrients, water, carbon dioxide, chlorophyll and sunlight as preparatory materials for the synthesis of carbohydrates and oxygen. Photosynthesis and bioenergy. The plant materials and animal wastes are used especially as a source of fuel. Teacher tip Suggested answers: 1. Through photosynthesis 2. Through cellular respiration A. 1. Components that are utilized: Carbon dioxide, water, sunlight (and chlorophyll can be mentioned) 2. Groups that come out: Carbohydrate (glucose) and oxygen B. 1. Groups that go in: Carbohydrate, oxygen and 38 ADP molecules 2. Groups that are released: Carbon dioxide, water and 38 ATP molecules • Which groups are released? • Chemical reactions for cellular respiration: C6H12O6 + 6 O2 + about 38 molecules of ADP 6 CO2 + 6 H20 + about 38 molecules of ATP • Which groups participate in the reaction? • Which groups are released? INSTRUCTION/DELIVERY (145 MINS) 1. You can draw pictures of photosynthesis and cellular respiration in Manila paper if LCD is not available. You can also go to computer/printing shop and make these pictures into tarpaulin for long use. • Sample picture of Overview of Photosynthesis, Overview of the Stages of the Calvin Cycle in Photosynthesis, Overview of Glucose Breakdown, and Overview of ATP Yield per Glucose Molecule may be viewed at Biology 10th Edition by Mader, Sylvia S. (2010) (Retrieved July 20, 2015) 2. Group your students into triad according to their learning skills. Give each member accountability task to promote mutual cooperation. 3. Give them questions to answer for discussions. Tell them to prepare and bring out their Manila paper and markers. 4. Have them report orally to the class. 5. Alternatively, if the class will not be able to report reliably, roleplaying, laboratory activities, or simulations involving computer-aided activities such as the ones found in the following sites: • http://www.reading.ac.uk/virtualexperiments/ves/preloader-photosynthesis-full.html • http://www.pbs.org/wgbh/nova/nature/photosynthesis.html Processing Questions: 1. What are the two kinds of reactions in photosynthesis? 2. What are the basic stages of the Calvin cycle? 3. What are the reactants and products of photosynthesis? 4. In which part of the cell glycolysis happens? What about the citric acid cycle and electron transport chain? 5. How many metabolic pathways are there in cellular aerobic respiration? In anaerobic respiration? 6. What are the reactants and products of cellular respiration? 
 Suggested Answers: Major Events and Features of Photosynthesis Major Events and Features of Cellular Respiration 92 Reaction Series Needed Materials End Products Light-dependent reactions (take place in the thylakoid membrane) a. Photochemical reactions b. Electron transport a. Light-energy; pigments (chlorophyll) a. Electrons b. Electrons, NADP+, H2O, electron acceptors b. NADPH, O2 c. Proton gradient, ADP + P, ATP synthase c. ATP Carbon fixation reactions (take place in stroma) 2. Ribulose bisphosphate, CO2, ATP, NADPH, necessary enzymes 2. Carbohydrates, ADP + P, NADP+ Stage Starting Materials End Products 1. Glycolysis (in cytosol) Glucose, ATP, NAD+, ADP Pi Pyruvate, ATP, NADH 2. Preparatory reaction Pyruvate, Coenzyme A, NAD+ Acetyl CoA, CO2, NADH 3. Citric acid cycle Acetyl CoA, H2O, NAD+, FAD, ADP Pi CO2, NADH, FADH2, ATP 4. Electron transport and chemiosmosis NADH, FADH2, O2, ADP Pi ATP, H2O, NAD+, FAD Activity: Gaseous Products of Photosynthesis NOTE: If there is enough time and the materials are available, let the class do this activity. Materials needed: 1000 mL beaker, 3 grams of sodium bicarbonate, Hydrilla or Elodea, funnel, test tube Procedure: 1. Half-fill a 1000 mL beaker with tap water. 2. Add 3 grams of sodium bicarbonate. 3. Place Hydrilla or Elodea in the bottom of the beaker. 4. Put a funnel over the plant. 5. Fill the test tube with water up to the brim. Secure the mouth of the test tube with your thumb. Invert the tube and place it on top of the funnel. 6. Place the beaker under direct sunlight. Count the bubbles that appear in the test tube after 30, 60, 90, 120, 150, 180, and 210 seconds. 7. After several minutes, slowly remove the test tube from the funnel. Place your thumb over its mouth. Turn the tube right up and insert a glowing match to the test the presence of the oxygen in the tube. Adapted from: Science and Technology II for the Modern World. (2003). Makati City: Diwa Scholastic Press, Inc. Note: An illustration of the set-up will help teachers and students to visualize how the experiment should be performed. ENRICHMENT (25 MINS) Directions: Show the basic similarity and differences between photosynthesis and cellular respiration. The options are provided for in the other table below. PART I Available Choices 94 Photosynthesis Cellular Respiration 1. Raw materials 2. End products 3. Electron transfer compound 4. Location of electron transport chain 5. Organelle involved 6. ATP production 7. Source of electron for ETC 8. Type of metabolic reaction 9. Terminal electron acceptor for electron transport chain a) O2 b) Anabolism c) Glucose, oxygen d) Carbon dioxide, water e) NADP+ is turned to NADPH f) NAD+ is turned to NADH+ g) Phosphorylation and oxidative phosphorylation h) Mitochondrial inner membrane (cristae) i) Chloroplast j) Mitochondrion k) Photophosphorylation l) Thylakoid membrane m) In noncyclic electron transport :H2O n) Immediate source: NADH and FADH2 o) Glucose, oxygen p) Catabolism q) In noncyclic electron transport: NADP+ r) Carbon dioxide, water