Download Bioinformatics: From Genes to Proteins and Databases and more Papers Computer Science in PDF only on Docsity! 1 Introduction to Bioinformatics and Internet Resources Oct 2003 Chun-Huai Cheng Hou-Chun Chou Genome: the complete DNA sequence of a life form (including genes and intergenic regions) Image credit: U.S. Department of Energy Human Genome Program http://www.ornl.gov/hgmis (functional region of the DNA) 2 From Genes to Proteins Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., Watson,. J, Molecular Biology of the Cell 3rd Ed, Garland, 105 (1994) How Genes are Translated DNA/RNA sequences are composed of 4 nucleotides DNA: A, T, G, C (RNA: A, U, G, C) Protein sequences are composed of 20 amino acids A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y DNA: ATGATACCCACGTACGGCATTTAA mRNA: AUGAUACCCACGUACGGCAUUUAA Protein: Met-Ile-Pro-Thr-Tyr-Gly-Ile (one letter code: MIPTYGI ) Transcription Translation 5 EBI Resources http://www.ebi.ac.uk/Databases/index.html Like NCBI, EBI also contains lots of databases and analytical tools for Bioinformatics researches e.g. EMBL is a DNA sequence database Swiss-Prot is a protein sequence database DDBJ Resources http://www.ddbj.nig.ac.jp 6 Application of Computer Science in Bioinformatics • Database technology: – Store and organize overwhelming biological data and provide efficient query tools – Statistical analysis and Data mining • Visualization: – Transform raw data into a more understandable format (Genome viewers*, Protein 3D structure viewers) • Development of Probabilistic Models and Algorithms : – Gene prediction*, Protein structure prediction – Similarity search* * Examples will be covered in this presentation Genome Viewer – Ensembl Human Genome Browser http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi 7 Genome Viewer – NCBI Map Viewer http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi Genome Viewer – UCSC Genome Browser http://genome.ucsc.edu/cgi-bin/hgGateway The latest human reference sequence (UCSC version hg16) is based on NCBI Build 34 All theses genome viewers provide decent tools to explore underlying sequence data 10 Bioinformatics Nucleic acid sequencing and analysis Gene finding Evolution tree Protein sequencing and analysis Molecular structure prediction 3D Modeling Molecular interaction Metabolic and regulatory networks Gene and protein expression data DNA chips/microarrays Drug screening Lead compound finding, drug design Proteomics The study and analysis of protein structure and function. Becoming an important science with the mapping of several genomes, including the human one, and the discovery of new proteins. Using information provided by proteomics and global experimental approaches, gene function can be accessed. (Functional genomics) 11 Principle for Protein Structure Amino acid sequence Secondary structure Tertiary structure Quaternary structure Yangene Biotechnology Company http://www.yangene.com/content22_10.htm Secondary structure and Motif α- helix motif 12 Motif Motif - A short, conserved region that is a common grouping of secondary structural elements - Why search a motif? 1. locate a functional site 2. to find a homologous sequences - PROSITE: protein motif database Tertiary structure and Domain Domain - Some polypeptide chains fold into two or more compact regions - Pfam,SMART: protein domain database Molecular Cell Biology, 4th Edition, By Harvey Lodish, published by W.H. Freeman & Co 15 The Protein Data Bank (PDB) The Protein Data Bank (PDB) Gateway to access PDB files Swiss-Prot, NCBI, EMBL Protein Data Bank CATH, SCOP, FSSP Databases that interpret PDB files Bioinformatics and Functional Genomics (John Wiley & Sons, October 2003) p285 16 Simple PDB Analysis Access to PDB from NCBI structure database : Molecular Modeling Database (MMDB) Cn3D, structure visualization software Vector Alignment Search Tool (VAST) Bioinformatics and Functional Genomics (John Wiley & Sons, October 2003) p291 Molecular Modeling Database (MMDB) 17 Vector Alignment Search Tool (VAST) PDB identifier Percent identity Value of structure similarity Protein Sequences, Structure, Function PROSITE sequence motif database SWISS-PROT protein sequence database PDB protein 3D structure database 1 0 1 Motif 1 100Protein 3 110Protein 2 010Protein 1 function1Partial structureMotif 2Protein name Data Mining extraction of association rules Data Analysis http://www.hgc.ims.u-tokyo.ac.jp/organize/takagilab/GInfo/rules.html