Introduction to Bioinformatics - Lecture Slides | BIOLOGY 101, Study notes of Animal Anatomy and Physiology

Download Introduction to Bioinformatics - Lecture Slides | BIOLOGY 101 and more Study notes Animal Anatomy and Physiology in PDF only on Docsity! Lecture 1 Introduction to Bioinformatics May 30, 2007 Intro/Overview Biological concepts • Instructor: Ameet Soni ( soni@cs.wisc.edu ) – 3rd year graduate student, Computer Sciences – Advisor: Jude Shavlik – Research: Machine learning and protein structure prediction • Office: 6740 Medical Sciences Center • Course Webpage: http://www.cs.wisc.edu/~soni/IBS07/ Overview • Molecular Biology 101 • Sequence Alignment • Phylogenetic Tree Inference • Gene Expression Analysis • Protein Structure Prediction Today • Molecular Biology 101 – DNA – RNA – Proteins – Central Dogma • Sequence Alignment • Phylogenetic Tree Inference • Gene Expression Analysis • Protein Structure Prediction Genes • genes are the basic units of heredity • a gene is a sequence of bases that carries the information required for constructing a particular protein (polypeptide really) • such a gene is said to encode a protein • the human genome comprises ~ 35,000 genes The “Central Dogma” of Molecular Biology DNA RNA PROTEIN Transcription Translation Deoxyribonucleic Acid (DNA) image from the DOE Human Genome Program http://www.ornl.gov/hgmis DNA – The “Blueprint” • genetic instructions for guiding development and function of living organisms • polymer: large molecule consisting of similar units • DNA consists of two complementary polymers bound together DNA as helix • DNA molecules usually consist of two strands arranged in the famous double helix Watson-Crick Base Pairs • in double-stranded DNA A always bonds to T C always bonds to G Double Stranded DNA ~ ~ ” Ww | | c— H SSS BES DART ET Tng O UO UO UO U BH =§ O U BE | “om Genomes • the term genome refers to the complete complement of DNA for a given species • the human genome consists of 46 chromosomes. • every cell (except sex cells and mature red blood cells) contains the complete genome of an organism The “Central Dogma” of Molecular Biology DNA RNA PROTEIN Transcription Translation RNA – the “Messenger” • RNA is like DNA except: – backbone different – usually single stranded – the base uracil (U) replaces thymine (T) • a strand of RNA can be thought of as a string composed of the four letters: A, C, G, U • Many functions –mRNA, rRNA, tRNA, etc. Steps in Transcription • Reads DNA 5’
3’ • Initiation – RNA polymerase docks on promoter region • Elongation – Build the chain (multiple simultaneously possible) • Termination – Certain sequence creates a hairpin loop Transcription i <i DNA 4TSCCGTTAGACCGTTAGCGGACCTGA TACGGCAATCTGGCAATCGCCTGGACT x oy mRNA Ped ey mRNA AUGCCGUUAGACCGUUAGCGGACCUGAC top strand coding strand sense strand bottom strand template strand antisense strand DNA-RNA Base Pairs A=U 5’ -AGCTAAGGGGC T TAAGGGAA-—3’ 3’-t¢éattetece trratt¢eett—5’ 3’ -UCGAUUCCCCG |ARBUUUUAUUCCCUU- 5’ CG=G The “Central Dogma” of Molecular Biology DNA RNA PROTEIN Transcription Translation Proteins – the “Workers” • proteins are molecules large molecules constructed of one or a complex of polypeptides • a polypeptide is a polymer composed of units called amino acids – 20 types • a polypeptide can be thought of as a string composed from a 20-character alphabet Amino Acids Alanine Ala A Arginine Arg R Aspartic Acid Asp D Asparagine Asn N Cysteine Cys C Glutamic Acid Glu E Glutamine Gln Q Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V Ribbon Model: Hemoglobin Protein Functions • structural support • storage of amino acids • transport of other substances • coordination of an organism’s activities • response of cell to chemical stimuli • movement • protection against disease • selective acceleration of chemical reactions The “Central Dogma” of Molecular Biology DNA RNA PROTEIN Transcription Translation Codons and Reading Frames a7 Cc Codon 1 U__| on ¢ Codon 2 G_] G A Codon 3 G_| es u Codon 4 u _ Cc G Codon 5 G_| A G Codon6 Cc UI A Codon? G_| First letter The Genetic Code Second letter c A OF ACA FP A Cl ARF NC HAFAN E Translation This process repeats until reaching a stop codon Growing. poly- 3 peptide RNA Splicing LY Chromosomal DNA t Transcription (RNA synthesis)  Protein Product Free Cee we Ce wa 8 CR he a Person Tf = a We la | Arg Sp Asn | Cys... 2 3 EI 5 er AGA GAT AAT TGTee. Person 2 arr rea ree are oa) fs m cs a P Fj AAA GAT AAT TGT... ie) E fi ir 3° wo roe or F a Fe] cs Ki - image from the DOE Human Genome Program http://www.ornl.gov/hgmis Post-translation • Central dogma is over, but in reality most polypeptides (particularly in eukaryotes) have to be modified in several ways – Poly A tail, methylated cap, chaperones help fold protein • Polypeptides also form proteins Overview of the E. coli Metabolic Pathway Map image from the KEGG database Gene Regulation Example: the lac Operon these proteins metabolize lactosethis protein regulates the transcription of LacZ, LacY, LacA lactose is absent ⇒ the protein encoded by lacI represses transcription of the lac operon Gene Regulation Example: the lac Operon Number of Base Pairs More Impressive Growth of the International Nucleotide Sequence Database Collaboration SUDA Ul Spey Soe gq PPP PY Base Pairs corlribuled by GenBark®—8© EMBL=" ODBJ=<8 g 2 But Wait, There’s More… • > 300 other publicly available databases pertaining to molecular biology (see pointer to Nucleic Acids Research directory on course home page) • GenBank > 65 million sequence entries > 120 billion bases • SWISS-PROT > 230 thousand protein sequence entries > 85 million amino acids • Protein Data Bank 37,269 protein (and related) structures * all numbers current about 9/06 Figure from Spellman et al., Molecular Biology of the Cell, 9:3273-3297, 1998 More Data:Gene Expression • this figure depicts one yeast gene- expression data set – each row represents a gene – each column represents a measurement of gene expresssion at some time point – red indicates that a gene is being expressed more than some baseline; green means less Other Data Types • Mass spectrometry: measure proteins , metabolites • Protein-protein interactions • ChIP-Chip: identify where protein binds DNA • Single nucleotide polymorphisms (SNPs) • High-throughput molecule screening Other Data Types • Auxotrophic growth experiments • 2D gels: dimensions are charge and molecular weight. • RNAi: a quicker way to knock out genes • X-ray crystallography and NMR (nuclear magnetic resonance) for protein structures Bioinformatics Revisited Representation/storage/retrieval/ analysis of biological data concerning – sequences (DNA, protein) – structures (protein) – functions (protein, sequence signals) – activity levels (mRNA, protein, small molecules) – networks of interactions (metabolic pathways, regulatory pathways, signaling pathways) of/among biomolecules