Understanding Mutations: Types, Mechanisms, and Effects on Genes and Proteins, Study notes of Genetics

Download Understanding Mutations: Types, Mechanisms, and Effects on Genes and Proteins and more Study notes Genetics in PDF only on Docsity! Sa ee STAN eda BC aC eG EU Introduction • How do we detect genes? 1. Detecting phenotypic changes in the organism due to changes in the gene. 2. Screening DNA sequences for ORFs with gene-like features or similarities to genes already known. • A mutation is a change in base sequence of a gene, or in the arrangement of genes on a chromosome (chromosome mutation, discussed more later). • A mutation produces a new allele of the gene. • The most common allele in a laboratory stock or wild population of an organism is called the wild type allele; then a mutation produces a new mutant allele. • A mutant is an individual carrying a mutant allele. Wild type Drosophila on the left; each of the three mutants is in a different gene. Mechanisms of Point Mutation (continued) 3. Some mutations are caused by mutagens Chemical mutagens modify bases so they cause mispairing when replicated or are repaired incorrectly. UV radiation links adjacent pyrimidines to form dimers, which may be repaired incorrectly. Ionizing radiation induces single- or double-stranded breaks, chemically modifies bases, or cross-links bases; may be repaired incorrectly. H. J. Muller When and Where Mutations Happen Mutations are stochastic events (unpredictable, random): we can never predict exactly when a mutation will occur or what kind of mutation will occur, but we can assign a probability (frequency or mutation rate) to it. Most mutations happen during cell division, so we usually measure the rate in mutations per cell division. Measured mutation rate would be 7 mutations/31 cell divisions or 0.226 mutations/cell division (unrealistically high example!). When and Where Mutations Happen In eukaryotes, mutations that occur in the somatic cells (somatic mutations) are not inherited; mutations that occur any time in the germ line are inherited. We usually measure the rate in mutations per gamete somatic mutation germ line mutation Germ line Soma Phenotypic Effects of Mutations in Exons Review code properties: • Degenerate • Triplet • Commaless • Start codon • Stop codon(s) Phenotypic Effects of Mutations Useful terms for phenotypes of mutations: Amorph = nullimorph = null = knockout mutations: mutant allele is completely inactive (not transcribed, or translated, or encodes inactive protein or RNA). e.g. white eye mutant in Drosophila melanogaster Hypomorph: mutant allele has reduce activity (reduced rate of transcription or translation, or encodes protein or RNA with reduced activity). e.g. apricot eye allele of white gene in D. melanogaster Neomorph = gain-of-function mutation: mutant allele has new activity (e.g. encodes protein or RNA with new enzymatic activity or turns one gene off and another one on or make a gene active in wrong tissue). e.g. Antennapedia in Drosophila The “morph” terminology was devised by H. J. Muller, who used it mainly to refer to mutation effects inferred from phenotypic effects. Consequences of Code Properties Fist Thre Degenerate (ee) {en u ¢ A 3 uuu ae ucu Ser) |UAU Why Ue crs) u Uo Juua Leu), [UGA Ser s Tea | BUG Leal4] UBS Ser deere & cuu CAU ts hy CEU Arg u ¢ tue »|cacns]¥/ eee mel] & aus Gah Gn}ofeca Aal") & cuG CAG GinJ°}cce Arg, G AUU ACU Thr) | AAU snl AGU Ser|. U A AUC ACC Thr| {| AAC AsnJ) AGC Ser! c AUA ACA Thr[ | AAA Ly: Tk AGA Arg] A Aca Thr) [AAG Lys!*| age Aral! G GUU Val? | GCU Ala GAU Aer GGU sia] u Gg GUC Val, | CC Ala .|GAc Aspl°/ Ge GIy, c GUA Val GCA Ala GAA Gitte GGA Gly A GUG Val, |6CG Ala} | GAG Glus*| a6 Gly. G and the three letzer format, Tae codon AUG, which codes for methionine (o0xed) is, fpenevally used for initation. The codans are conventionally writzen with the bi threleltand they’ basen the right Phenotypic Effects of Mutations • Triplet • Commaless Phenotypic Effects of Mutations • Triplet • Commaless Deletions of 1 or 2 bp are frameshift mutations. Consequences: CACCATGGTGCACCTGACTCCTGAG…CACUAAGCU CACCATGGTGACCTGACTCCTGAG…CACUAAGCU Met Val His Leu Thr Pro Glu His Term − C Met Val Thr Term CACCATGGTGCCACCTGACTCCTGAG…CACUAAGCU + C Met Val Pro Pro Asp Ser Term − CT CACCATGGTGCACCTGACTCGAG…CACUAAGCU Met Val His Leu Thr Arg ? Leu Ser Phenotypic Effects of Mutations Deletions of 1 or 2 bp in exons are frameshift mutations. Consequences: • Change of one or more amino acids; phenotype depends on the amino acids and their location. • Premature termination. • Late termination. • Usually nullimorphs or hypomorphs. CACCATGGTGCACCTGACTCCTGAG…CACUAAGCU CACCATGGTGACCTGACTCCTGAG…CACUAAGCU Met Val His Leu Thr Pro Glu His Term − C Met Val Thr Term (termination, or stop) CACCATGGTGCCACCTGACTCCTGAG…CACUAAGCU + C Met Val Pro Pro Asp Ser Term − CT CACCATGGTGCACCTGACTCGAG…CACUAAGCU Met Val His Leu Thr Arg ? Leu? Ser? Mutations Due to Transposable Elements Transposable elements (TEs) are segments of DNA that can move from one location to another in the genome, or have a copy made and moved to a new location. Insertion of a TE in a gene can cause frameshifts or cause additional amino acids to be added to a protein product. This usually results in a null mutation. Insertion of TEs in controlling elements or between a gene and its controlling elements can cause major changes in transcription (no transcription or transcription at inappropriate times and/or places. Transposable elements are more common in some organisms (e.g. Drosophila melanogaster) than in others and can cause a major proportion of all visible mutations. Genes Encoding Enzymes and Auxotrophic Mutants Some genes code for enzymes. Many enzymes catalyze steps in biosynthetic pathways. Steps are sequential, enzymes act sequentially. Usually, 1 enzyme catalyzes 1 reaction or step in a pathway. Genes G1 G2 G3 Enzymes E1 E2 E3 A B C D e.g. tryptophan biosynthesis in E. coli: Text says 5 steps but don’t show the pathway. Chorismic acid Anthranilic acid PRA CDRP InGP Indole L-Tryptophan ASase trpE PRTase trpD InGPSase trpC TSaseB trpB TSaseA trpA Notice that names of genes are italicized (or underliuned). Genes Encoding Enzymes and Auxotrophic Mutants Special classes of mutants especially useful with microorganisms: Antibiotic-resistant Auxotrophic: can’t make essential nutrient, must be supplied in culture medium •Test for growth on minimal medium (MM) which has things wild type needs (energy, C, N sources; salts; etc.); only wild type (prototroph) grows, because it can make everything it needs from these simple ingredients. •Control is complete medium (CM) which has yeast extract, proteose peptone, etc. that supply everything; all genotypes grow. One Gene - One Enzyme Hypothesis: not quite right, but focused on idea that genes have their phenotypic effects by encoding proteins. Phenotypic Effects of Mutations in Introns Usually no effect unless mutation in splicing signal sequence --> failure to remove intron or splicing at incorrect site. ATG GTG CAC … GCAGgttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggag AcagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccacccttagGCTGCTG GTGATGGTGCAC … GCAGGCTGCTGG ΔG No splicing, wrong amino acids up to a stop codon ATG GTG CAC … GCA Ggt ggt atc aag gtt aca aga cag gtt taa gga gac caa tag aaa ctg ggc atg tggagacagagaagactcttggg ttt ctg ata ggc act gac tct ctc tgc cta ttg gtc tat ttt ccc acc ctt agG CTG CTG GTG Phenotypic Effects of Mutations in Genes Encoding Functional RNAs rRNA genes Complicated because rRNA genes present in hundreds or thousands of copies (tandem repeats); mutation affects only one, in which case has little or no effect, but can spread to all copies after many generations. The mechanism of spreading is unequal crossing- over and gene conversion, which we will discuss later in the course. If it spreads, can have no effect, nonfunctional or subfunctional RNAs and ribosomes, no or reduced synthesis of all proteins encoded same genome. Often lethal or very detrimental. Phenotypic Effects of Mutations in Genes Encoding Functional RNAs tRNA genes Mutations in the anticodon, or in the region that is recognized by the aminoacyl tRNA synthetase, can result in wrong amino acids being inserted at many sites in many proteins.