Molecular Analysis of Microbial Communities: DNA Extraction, PCR, & Sequencing, Study notes of History of Education

Download Molecular Analysis of Microbial Communities: DNA Extraction, PCR, & Sequencing and more Study notes History of Education in PDF only on Docsity! Microbial Community Analysis Boris Wawrik, Ph.D. Molecular methods Advantages Disadvantages Open questions Outline What can molecules tell us ? DNA extraction – methods sample preservation and results Describing a microbial community with molecular tools – PCR and primer design – TA-cloning and clone libraries – Screening for diversity in clone libraries by ARDRA Hypothesis testing in microbial ecology – DGGE – TRFLP – FISH – SIP – Real-time PCR – Remote sensing What can molecules tell us ? The Central Dogma of Molecular Biology DNA Who is there ? Who is not there ? What functional genes are there ? BUT can not tell you who is active RNA Who is active ? Who is expressing genes? Protein Enzyme activity Rate measurement (e.g. primary production by 14C carbon fixation) Sample preservation: Crucial depending on target DNA Preferred by most people, because easiest to work with DNA is usually stable as long as sample is frozen in TE buffer Soil can be frozen directly Water samples are best filtered onto 0.22 or 0.45 µm filters and filters stored in TE RNA RNA degrades rapidly because RNAse is EVERYWHERE (!!) DEPC (diethylpyrocarbonate) treat all reagents (inactivates enzymes) Bake glassware at 450ºC overnight Store samples in specialized buffers to prevent RNA degradation Protein Assays are usually are preformed immediately with source material and not stored DNA is the preferred target for most people Easy to work with There are many extraction methodologies DNA is fairly stable – can be frozen for years Old methods Organic phase extractions with phenol and chloroform Precipitation with ethanol or isopropanol Newer methods Binding to a column that contains charged silica or activated cellulose Salt and pH are used to wash away impurities and to elude DNA Extraction methods Who are all these uncultivated bacteria ? Microbial Life-’02 Perry et al.(Woese, Giovannoni, Ward, Stahl, Pace and others – late 1980s and early 1990s) There are regions that are highly similar among all bacteria These regions can be used to design universal 16S PCR primers Using these primers we can amplify the 16S sequences from a natural population This mixture of PCR products can be cloned and the inserts from individual colonies sequenced How do we estimate bacterial community composition ? Streptomyces nodosus AAK73514 I Streptomyces nodosus AAK73514 V Streptomyces noursei AF263912 IV Streptomyces noursei AF263912 Streptomyces natalensis AJ278573 V Streptomyces natalensis AJ278573 III Streptomyces natalensis AJ278573 IV Streptomyces natalensis AJ278573 I Streptomyces noursei AF263912 I Streptomyces natalensis AJ278573 VI Streptomyces sp. FR-008 AY310323 I Streptomyces sp. FR-008 AY310323 VI Streptomyces sp. FR-008 AY310323 V Streptomyces natalensis AJ278573 II Streptomyces nodosus AAK73514 III Streptomyces nodosus AAK73514 VI Streptomyces nodosus AAK73514 II Streptomyces nodosus AAK73514 IV Streptomyces noursei AF263912 III Streptomyces noursei AF263912 II Streptomyces noursei AF263912 V Streptomyces noursei AF263912 VI Streptomyces nanchangensis AF521085 II Streptomyces cinnamonensis AF440781 II Streptomyces natalensis AJ132222 I Streptomyces natalensis AJ132222 II Streptomyces caelestis AF016585 II Streptomyces caelestis AF016585 III Streptomyces hygroscopicus AAF86396 V Streptomyces hygroscopicus AAF86396 IV Streptomyces hygroscopicus AAF86396 II Streptomyces hygroscopicus AAF86396 III Streptomyces venezuelae T17409 II Streptomyces avermitilis BAB69303 II Streptomyces sp. HK803 AAQ84157 II Streptomyces sp. HK803 AAQ84157 I Streptomyces sp. FR-008 AY310323 II Streptomyces sp. FR-008 AY310323 III Streptomyces sp. FR-008 AY310323 IV Streptomyces natalensis AJ132222 III Streptomyces natalensis AJ132222 IV Streptomyces avermitilis BAB69303 III Streptomyces halstedii BAD08359 III Streptomyces halstedii BAD08359 II Streptomyces noursei AF263912 VII Streptomyces fradiae AAB66504 II Streptomyces antibioticus AF220951 II Streptomyces antibioticus AF220951 III Streptomyces venezuelae T17409 III Streptomyces venezuelae T17409 I Streptomyces coelicolor A3 NP 733695 I Streptomyces antibioticus AF220951 I Streptomyces nanchangensis AF521085 I Streptomyces cinnamonensis AF440781 I Streptomyces griseoruber AY196994 I Micromonospora griseorubida AB017641 I Micromonospora griseorubida AB089954 I Streptomyces fradiae AAB66504 I Streptomyces caelestis AF016585 I Saccharopolyspora erythraea AY330485 I Saccharopolyspora spinosa AY466441 I Streptomyces avermitilis AB070949 I Streptomyces avermitilis AB070949 Streptomyces avermitilis BAB69303 I99 99 53 39 51 35 11 7 23 9 16 35 99 99 99 99 87 99 99 94 99 98 99 77 57 99 99 85 99 64 73 46 66 97 56 99 90 99 87 96 92 53 54 44 56 32 35 25 43 20 15 19 11 22 6 2 4 09 1 0.05 C G C C T T 140 G A A G G C C G C C 150 G T C T C G T G C C 160 G G T C G T T C T G 170 G C G G G T G C C C 180 G AC C C G T G C G 190 C G T T G AT G T A 200 G T C G A T G T C C 210 T C G G G G G C Phylogenetic analysisDNA extraction Sequencing Library screeningPrimer design and PCR Comparison to other samples – hypothesis testingTA cloning BM aera as) tte lie Edit View Go Bookmarks Tools Help > > 2G ( asm—search © siast Bf comepy central © Entrez-PubMed |G] Google Scholar [|] Hotmail [1] Online Journals A-Z WY Rutgers University Li... [] Rutgers “XP Yahoo! |) Please signin @® | tte: /frmaw.ncbi.nim.rih.gav fentrez/query.fegi?db PubMed +] © co [ICL | a (Sign Inj [Register] About Ent ae one or more search terms, or click Preview/Index for advanced ucture a Slee Genome png. Fe Books author names as smith jc. Initials are optional. CancerChromasomes journal titles in full or as MEDLINE abbreviations. Use the i BAConserved Domains nls Database to find journal titles. Orewen] YQ Domains Ria Tutorial Service of the National Library of Medicine, includes over 15 pns for biomedical articles back to the 1950's. These citations & GEO Profiles EDLINE and additional life science journals. PubMed includes GEO DataSets —ly sites providing full text articles and other related resources. RESEPE vcSH pve acne Sibiaed NCBI Web Site lecular Biology ofthe Anew default filter, Review, is TEIN NLM Catalog Ml, 4th Ed. and The now available for all PubMed Sew OMIM ibnetic Landscape of searches. Oe Gea 1: Plabetes are iiow My NCBI has replaced the Cubby LinkOut available for interactive and includes automatic e-mailing My NCBI (Cubby) searching on the of search updates and filters for Bookshe search results. NLM Catalog = NET New Global NCBI Search Engine NCBI's growing number of Entrez databases can now be searched at once! Go Les) Ce ROL ante) Write to the Help Desk NCBI | NEM | NIH Department of Health & Human Services Pr Done TA-cloning (cont.) Ligate the mixed PCR product from a mixed natural population in to a TA-vector we get a mixed population of clones (different sequences in different clones) Problem : Sequencing is expensive We need to prescreen to select clones for sequencing + mixed PCR product TA-vector How to screen clones: ARDRA A B C A B C 4bp RE Individual clones are PCR amplified using the gene specific primers The PCR products are then cut with a 4 bp cutting restriction endonuclease The cut products are run on 3% low melting point agarose gel Banding patterns are compared either visually or by means of special (and very expensive) software Unique clones are selected for sequencing Streptomyces nodosus AAK73514 I Streptomyces nodosus AAK73514 V Streptomyces noursei AF263912 IV Streptomyces noursei AF263912 Streptomyces natalensis AJ278573 V Streptomyces natalensis AJ278573 III Streptomyces natalensis AJ278573 IV Streptomyces natalensis AJ278573 I Streptomyces noursei AF263912 I Streptomyces natalensis AJ278573 VI Streptomyces sp. FR-008 AY310323 I Streptomyces sp. FR-008 AY310323 VI Streptomyces sp. FR-008 AY310323 V Streptomyces natalensis AJ278573 II Streptomyces nodosus AAK73514 III Streptomyces nodosus AAK73514 VI Streptomyces nodosus AAK73514 II Streptomyces nodosus AAK73514 IV Streptomyces noursei AF263912 III Streptomyces noursei AF263912 II Streptomyces noursei AF263912 V Streptomyces noursei AF263912 VI Streptomyces nanchangensis AF521085 II Streptomyces cinnamonensis AF440781 II Streptomyces natalensis AJ132222 I Streptomyces natalensis AJ132222 II Streptomyces caelestis AF016585 II Streptomyces caelestis AF016585 III Streptomyces hygroscopicus AAF86396 V Streptomyces hygroscopicus AAF86396 IV Streptomyces hygroscopicus AAF86396 II Streptomyces hygroscopicus AAF86396 III Streptomyces venezuelae T17409 II Streptomyces avermitilis BAB69303 II Streptomyces sp. HK803 AAQ84157 II Streptomyces sp. HK803 AAQ84157 I Streptomyces sp. FR-008 AY310323 II Streptomyces sp. FR-008 AY310323 III Streptomyces sp. FR-008 AY310323 IV Streptomyces natalensis AJ132222 III Streptomyces natalensis AJ132222 IV Streptomyces avermitilis BAB69303 III Streptomyces halstedii BAD08359 III Streptomyces halstedii BAD08359 II Streptomyces noursei AF263912 VII Streptomyces fradiae AAB66504 II Streptomyces antibioticus AF220951 II Streptomyces antibioticus AF220951 III Streptomyces venezuelae T17409 III Streptomyces venezuelae T17409 I Streptomyces coelicolor A3 NP 733695 I Streptomyces antibioticus AF220951 I Streptomyces nanchangensis AF521085 I Streptomyces cinnamonensis AF440781 I Streptomyces griseoruber AY196994 I Micromonospora griseorubida AB017641 I Micromonospora griseorubida AB089954 I Streptomyces fradiae AAB66504 I Streptomyces caelestis AF016585 I Saccharopolyspora erythraea AY330485 I Saccharopolyspora spinosa AY466441 I Streptomyces avermitilis AB070949 I Streptomyces avermitilis AB070949 Streptomyces avermitilis BAB69303 I99 99 53 39 51 35 11 7 23 9 16 35 99 99 99 99 87 99 99 94 99 98 99 77 57 99 99 85 99 64 73 46 66 97 56 99 90 99 87 96 92 53 54 44 56 32 35 25 43 20 15 19 11 22 6 2 4 09 1 0.05 ACACAGATCTAAGGAAGAGGGAGTCTAGAATGGCTAGCAAAGGAGAAGAACT TTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGC ACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCT TACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACAC TTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATA TGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGA ACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTC AAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTT AAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACA CAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCA AAATTCGCCACAACATTGAAGA DGGE (cont.) Advantages Can cut individual bands and clone or sequence them Can detect very small differences in DNA sequences Disadvantages High complexity samples give smears Requires specialized gel rig Acryl-amide is highly toxic TRFLP (Transcribed Restriction Fragment Length Polymorphism) fragment size FU cut with 4bp RE Mixed population is amplified using a 16S primer with a fluorescent tag PCR product is cut with a 4bp cutting restriction endonuclease Different sequences will give different length fragments Sample is injected into a capillary sequencer to sort fragments by size TRFLP (cont.) Advantages Very sensitive Fast, easy and cheap Disadvantages Can NOT cut bands to get sequence data Requires capillary sequencer Hard to distinguish noise from little peaks sometimes Quantitative PCR (real-time PCR) fluorochrome/quencher labeled probe in addition of PCR primers 5’-3’ exonuclease activity of the polymerase degrades the probe during amplifications releasing the flurochrome Laser + detector read fluorescence in reaction tube, which is proportional to amplification pg plasmid DNA 0.001 0.01 0.1 1 10 100 1000 C T 15 20 25 30 35 40 A pg rbcL mRNA 0.001 0.01 0.1 1 10 100 1000 C T 15 20 25 30 35 40 B Stable isotope probing A population is grown on a substrate that contains 13C carbon Cells that eat the 13C labeled substrate will incorporate it into their DNA. Dormant cells will not DNA extracted and heavy (13C containing) DNA is separated from light (only 12C containing) DNA by CsCl density gradient centrifugation The heavy band is isolated and the community analyzed by PCR – TA cloning approach 13C apple pieBacterial population + grow on labeled substrate 12C DNA 13C DNAextract DNA/RNA C sC l gradient centrifugation FISH (cont.) Advantages Allows visualization of a particular population of cells (e.g. a species of interest) Gives quantitative information about a microbial population Can probe for DNA, mRNA and ribosomal RNA Disadvantages Cross-hybridization Different groups often do not add up to 100% of the population Relatively expensive and time consuming (bacterial population) (chromosome mapping) hd 4 cs iia) Gulf of Mexico rele) 1 3 8 4 5 2 6 7 0 20 40 60 D is si m ila rit y Non plume Diatom plume Syn plume ST6 ST5 ST4 ST3 ST2 ST7 ST8 ST1 % 0 10 20 30 40 50 60 % chl a due to diatoms % chl a due to Syn 6A 5A 4A 3A 2A 7A 8A 1A P ro & S yn c el ls m l-1 0.0 5.0e+4 1.0e+5 1.5e+5 2.0e+5 2.5e+5 P ic oe uk c el ls m l-1 0 1000 2000 3000 4000 5000 Prochlorococcus Synechococcus Picoeukaryotes