Download Bioinformatics Course Material: CAP5510 Introduction to Bioinformatics - Prof. Giri Narasi and more Study Guides, Projects, Research Computer Science in PDF only on Docsity! 2/22/07 CAP5510 1 CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/BioinfS07.html 2/22/07 CAP5510 2 Structure Prediction Flowchart http://www.russell.embl- heidelberg.de/gtsp/flowchart2.html
Prokaryotic Gene Characteristics
DNA PATTERNS IN THR FE. coly JexA GENE
GENE SEQUENCE PATTERN
1 GAATTICGATAAATC TCTGGTITATIGNGC AGTITALGGLT: CTGNNNNNNNNNNCEG
Tr TIGACA
41 CCARARICGCCTITTGCEG TATA TACTOACAGCATBACTG CTGNNNNNNNNNNCAG
CCBA -35 -10 TATACT > TATAAT, > mRNA start
81 TATA TACACCCAGGGGGCGGAATGAAAGCGTTAACGGCCA CIGNNNNNNNNNNCAG
+10 GGGGG Ribosomal binding site GGAGG
121 GGCRACARGAGGTGTTITGATCTCATCCGTGATCACRTICAG
161 CCAGACAGETATSCCECCEACECE TECEGABATC GCGCAG ATG
201 CGTTTEGGGTICCETICCCCABACGCGGCTGRAGBACATC
241 TGAAGGCGC TGGCACGCAAAGGCGTTATTGABATTGTITC
281 CGGCGCATC ACGCGGGATICGICTGTIGCAGGAAGAGGAA
321 GRAGGGTIGCCECTGGTAGETCETETSGC TACCGGTEAAC
361 CACTICTGGCGCAACAGCATATTGBRAGGTCATTATCAGGT OPEN READING FRAME
401 CGATCCTICCTTATTICARGCCGARTSCTGATTICCISCTS
441 CGCGTCAGC EGGATGTCGATGARA GATATCGGCATTATGC
481 AIGGTGACTIGCTGGCAGTGCATARRACTCAGGATGTACE
521 TAACGGICAGGICGTTGICGCACGTATIGATGACGAAGTT
TUL RAATIMRCARAMRABRRALCRGAACRATRBEGTCOGRBRC
601 TGTTGCCAGARAATAGCGAGTITAARACCAATIGTCGTIGA
641 CCTICGTICAGCAGAGCTIC ACCATTGBAGGGCTEGCGGTT
681 GGGGTTATTCGCAACGGCGACTGGCTGTAACATATCICTG TAA
721 AGRCCECGATECCSCCTESGCHICECGSTTTGLITTICATC
761 WICTICATCAGGCTIGICTGCATGECATICCTCACTICA
801 TCTGATARAGCACTCTGGCATCTCGCCTTACCCATGATTT
841 TCTCCAATATCACCGTICCSTIGC TEGGACTGSTCGATAC
8E1 GGCGGTAATTGGICATCTTGRTAGCCCGGTITATTIGGGC
921 GECETGGCEGTTSSCECARCGGCEGRCCAGCT
Shown are matches to approximate consensus binding sites for LexA
repressor (CTGNNNNNNNNNNCAG), the -10 amd -35 promoter regions
relative to the start of the mRNA (TTGACA and TATAAT), the ribosomal
binding site on the mRNA (GGAGG), and the open reading frame
(ATG...TAA}, Only the second two of the predicted Lexa binding sites
actually bind the repressor.
FIGURE 9.6. ‘The promoter and open reading frame of the F. coli le
2/22/07 CAP5510
2/22/07 CAP5510 6 Gene Expression Process of transcription and/or translation of a gene is called gene expression. Every cell of an organism has the same genetic material, but different genes are expressed at different times. Patterns of gene expression in a cell is indicative of its state. 2/22/07 CAP5510 7 Hybridization If two complementary strands of DNA or mRNA are brought together under the right experimental conditions they will hybridize. A hybridizes to B ⇒ A is reverse complementary to B, or A is reverse complementary to a subsequence of B. It is possible to experimentally verify whether A hybridizes to B, by labeling A or B with a radioactive or fluorescent tag, followed by excitation by laser. Microarray Data 2/22/07 CAP5510 10 Gene Expression Level Gene1 Gene2 Gene3 … Gene Chips 2/22/07 CAP5510 11 2/22/07 CAP5510 12 Gene g Probe 1 Probe 2 Probe N… What’s on the slide?
Shining a laser light at GeneChipe array causes tagged DNA fragments that hybridized to glow
jeneChip® array
2/22/07 CAP5510 15
DNA Chips & Images 2/22/07 CAP5510 16 2/22/07 CAP5510 17
2-color DNA
microarray
oem
2/22/07 CAP5510 20
http://www.arabidopsis.org/info/2010_projects/comp_proj/AFGC/RevisedAFGC/Friday/
2/22/07 CAP5510 21 Sample Treated Sample(t1) Expt 1 Treated Sample(t2) Expt 2 Treated Sample(t3) Expt 3 … Treated Sample(tn) Expt n Study effect of treatment over time 2/22/07 CAP5510 22 Variations in cells/individuals. Variations in mRNA extraction, isolation, introduction of dye, variation in dye incorporation, dye interference. Variations in probe concentration, probe amounts, substrate surface characteristics Variations in hybridization conditions and kinetics Variations in optical measurements, spot misalignments, discretization effects, noise due to scanner lens and laser irregularities Cross-hybridization of sequences with high sequence identity. Limit of factor 2 in precision of results. Sources of Variations & Errors Need to Normalize data Hierarchical Clustering: Example 2/22/07 CAP5510 25 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 A Dendrogram 2/22/07 CAP5510 26 2/22/07 CAP5510 27 Hierarchical Clustering [Johnson, SC, 1967] Given n points in Rd, compute the distance between every pair of points While (not done) Pick closest pair of points si and sj and make them part of the same cluster. Replace the pair by an average of the two sij Try the applet at: http://www.cs.mcgill.ca/~papou/#applet 2/22/07 CAP5510 30 Clustering of gene expressions Represent each gene as a vector or a point in d-space where d is the number of arrays or experiments being analyzed. 2/22/07 CAP5510 31 From Eisen MB, et al, PNAS 1998 95(25):14863-8 Clustering Random vs. Biological Data
2/22/07
a eee
t 2
ose ogee
:
eR ee ee ee a a)
Expression Profiles for
Respiration Genes
CAP5510
32
2/22/07 CAP5510 35 K-Means Clustering: Example Example from Andrew Moore’s tutorial on Clustering.
Start
K-means
(eg. k=5)
2. Randomly guess k
cluster Center
locations
pre © 204 seam Mae
K-means
3. Each datapoint finds
‘out which Center it's
closest to. (Thus
each Center “owns”
2 set of datapoints)
2/22/07
CAP5510
K-means
(eg. k=5)
2. Randomly guess k
cluster Center
locations
3. Each datapoint finds
‘out which Center it's
dlosest to.
4. Each Center finds
the centroid of the
points it owns
pre © 204 seam Mae
K-means
3. Each datapoint finds
‘out which Center it's
dlosest to.
4, Each Center finds
the centroid of the
points it owns...
5S. ..and jumps there
6. ...Repeat until
terminated!
36
K-means
continues
er © St An Mee
2/22/07
CAP5510
K-means
continues
Sere 6 201 dado Mae
K-means
continues
er © St An Mee
37
2/22/07 CAP5510 40 K-Means Clustering [McQueen ’67] Repeat Start with randomly chosen cluster centers Assign points to give greatest increase in score Recompute cluster centers Reassign points until (no changes) Try the applet at: http://www.cs.mcgill.ca/~bonnef/project.html 2/22/07 CAP5510 41 Comparisons Hierarchical clustering Number of clusters not preset. Complete hierarchy of clusters Not very robust, not very efficient. K-Means Need definition of a mean. Categorical data? More efficient and often finds optimum clustering. 2/22/07 CAP5510 42 Functionally related genes behave similarly across experiments 2/22/07 CAP5510 45 SOM Algorithm Select SOM architecture, and initialize weight vectors and other parameters. While (stopping condition not satisfied) do for each input point x winning node q has weight vector closest to x. Update weight vector of q and its neighbors. Reduce neighborhood size and learning rate. 2/22/07 CAP5510 46 SOM Algorithm Details Distance between x and weight vector: Winning node: Weight update function (for neighbors): Learning rate: iwx − )]()()[,,()()1( kwkxixkkwkw iii −+=+ µ i i wxxq −= min)( ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ −− = 2 2 )( exp)(),,( 0 σ ηµ xqi rr kixk 2/22/07 CAP5510 47 World Bank Statistics Data: World Bank statistics of countries in 1992. 39 indicators considered e.g., health, nutrition, educational services, etc. The complex joint effect of these factors can can be visualized by organizing the countries using the self-organizing map. World Poverty Map 2/22/07 CAP5510 50
“6214 substances (155 selected) 7 microarras|PC4 - 6 components - Log
Summary
Graph Visualizations |Fesults | Parameters | Report
Features: 0 (0 selected) Ratio of Medians (635/532)
sox
Summary | Graph Yisualizations |Fesults | Parameters Report
6214 substances (155 selected) 7 microarras 50M - 4 x 4 clusters - Euclidean -Log Features: 0 (0 selected) [Ratio of Media 7
2/22/07 CAP5510 55 Neural Networks ΣInput X Synaptic Weights W ƒ(•) Bias θ Output y 2/22/07 CAP5510 56 Learning NN × × × Σ Σ Adaptive Algorithm Input X 1 Weights W − + Desired Response Error 2/22/07 CAP5510 57 Types of NNs Recurrent NN Feed-forward NN Layered Other issues Hidden layers possible Different activation functions possible 2/22/07 CAP5510 60 A A A B A B B B Learning Problems 2/22/07 CAP5510 61 SVM – Binary Classification Partition feature space with a surface. Surface is implied by a subset of the training points (vectors) near it. These vectors are referred to as Support Vectors. Efficient with high-dimensional data. Solid statistical theory Subsume several other methods. 2/22/07 CAP5510 62 Learning Problems Binary Classification Multi-class classification Regression
SVM | SVM
Dataset Features | FP | FN | FP | FN
Ovarian(origmal) | 97802 [46 [48 | 6 3
= ——- - Qvarian{madified) | 97302 [44] 34] 0 | 0
fot - Festure | FE _ EN a as AML/ALL train 72g [06] 28| o 6
corona 2 Se 2G ‘AML treatment m2 | 48/35] 3 2
Gore uendduct 3 192 2 Is Colon 200 [salar] 3 | 3
dleprodduet 402 Bo
TapaTact I? TH
dol-prod 32 u Table 5: Results for the perceptron on all data seta. The results are averaged over 5 shufllings of the data
dot-product 5 32 Hu as this algorithm is sensitive to the order in which it receives the data points. The first column is the dataset
fot mnt i = used and the second is number of features in the dataset. For the ovarian and colon datasets, the number
aotared 33 2 of normal tissues misclassified (FP) and the number of tumor tissues misclassified (FN) is reported. For the
dot-produet 3 53 2 AML/ALL training dataset, the number of AML samples misclassified (FP) and the number of ALL patients
dot-product UM x3 w misclassified (FN) is reported. For the AML treatment dataset, the number of unsuccessfully treated patients
ae ys a misclassified (FP) and the number of successfully treated patients misclassified (FN) is reported. The last two
detect 5 24 i colurnns report the best score obtained by the SVM on that dataset.
dot-pruiduet 10 43 is
det-product 0 7 3 a
Sot-prodluct 2 593 UB
dol-prosduel 3 303 uu LB
product 10 5 3 il
rr
9 2 2 s
dot-roduct 5 7 3 4
dot-prodtuct 10 5 3
Table 1: Brror rates for ovarian cancer tissue experiments.
For eadh setcing of t consisting of a Lemel snd diagonal favcor (DF), exch dame wes elaseified.
varved axe the munber of nomnsl «issues misclassified (FP
sified exarectly (TP). 2
2 ia the mmber of features felomes! used.
issues misclassified (FN), tumor tissues
nd normal
ied oonreetly (TN).
si ob
lhe (Meat
I"
Figure 1:
which is the distance of an
negative value indicates an incor
seoam] raost negative poi: oorr
VM classification margins for ovarian tissues. When dlassifving, the SV
mple from the decision boundary it las eared, In this grap
cach tisme sample caleulated using (10) is shown,
©
1
calenlates a margin
. ‘Lhe most negative
HWBC3.
2/22/07 CAP5510 66 SVM – General Principles SVMs perform binary classification by partitioning the feature space with a surface implied by a subset of the training points (vectors) near the separating surface. These vectors are referred to as Support Vectors. Efficient with high-dimensional data. Solid statistical theory Subsume several other methods. SVM Example (Radial Basis Function) 2/22/07 CAP5510 67 2/22/07 CAP5510 70 Classification of (Separable) 2-D data 2/22/07 CAP5510 71 Classification of (Separable) 2-D data •Margin of a point •Margin of a point set +1 -1 2/22/07 CAP5510 72 x Separator w•x + b = 0 w•xi + b > 0 w•xj + b < 0 x Classification using the Separator 2/22/07 CAP5510 75 Perceptron Algorithm (Dual) Given a separable training set S a = 0; b0 = 0; R = max xi repeat for i = 1 to N if yi (Σaj yj xi•xj + b) ≤ 0 then ai = ai + 1 b = b + yiR2 endif Until no mistakes made within loop Return (a, b) Non-linear Separators 2/22/07 CAP5510 76 2/22/07
Main idea: Map into feature space
Input space , Feature space
a *
°
Soya)
. =. he s
.
Figure 2, The dea of SV machines: map the trang dala
noninearty intoa higher-dimersional feature space via
5, and construct a separating iyperplane with maximum
nergn them, Ths yells a nonlinear decsion boundary in
npul space, By the use ofa kemel function, is possible
lo @mpuite the separating hyperplane without explicitly
carrying aut the map into the feature space.
CAP5510
77
2/22/07 CAP5510 80 Perceptron Algorithm (Dual) Given a separable training set S a = 0; b0 = 0; R = max xi repeat for i = 1 to N if yi (Σaj yj (xi ,xj) + b) ≤ 0 then ai = ai + 1 b = b + yiR2 Until no mistakes made within loop Return (a, b) (xi ,xj) = Φ(xi)• Φ(xj) 2/22/07 CAP5510 81 Different Kernel Functions Polynomial kernel Radial Basis Kernel Sigmoid Kernel dYXYX )(),( •=κ ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ −− = 2 2 2 exp),( σ κ YX YX ))(tanh(),( θωκ +•= YXYX 2/22/07 CAP5510 82 SVM Ingredients Support Vectors Mapping from Input Space to Feature Space Dot Product – Kernel function
Leamed threshold Optimized threshold
Class Method FP_FN_TP__TN Cost|FP_FN TP TN Cost
Tricatboxylic acid Radial SVM Ss 8 9 242 24] 4 7 10 266 18
Dotproduct-l SVM| 119 8 2439-29] 36 Ls 2471S
Dotproduct2SVM| 5 10 7 2445 25] 4 6 11 2446 16
Dot-product3 SVM| 4 12 5 2446 28] 4 6 11 2446 16
Parzen 4°12 5 2446 28] 0 12 5 2450 24
FLD 9 10 7 241 29/7 8 9 2443 28
CAs 717 0 41
Mocl 3016 1 3s] - - - - -
Respiration Radal SVM 76 Dl] Ss 4 26 29 16
Dotproduct-1 SVM | 21 10 41] 6 9 21 231 24
Dotproduct2 SVM | 7 14 35] 7 6 24 243019
Dotproduct-3 SVM | 3-15 33] 7 6 24 2430 19
Parzen 2 10 a2] 7 12 18 2430 31
FLD 10 10 30/14 4 26 2423-22
as 1s 17 2
Mocl R26 @i|- - - - -
Ribosome Radial SVM y 4 w| 6 1 2 240 6
Dotproduct-1 SVM | 136 25/11 1 120 23353
Dotproduct-2 SVM | 7 10 27/9 1 120 2337
Dotproduct3 SVM | 3 18 39] 7 1 120 23399
Parzen 6 8 2/5 8 13 241 21
FLD BS 25] 8 3 8 2238 4
CAS 3121 Bl- - - - -
Moc 26 26 78
‘Table 2: Comparison of error rates for various classification methods. Classes are as described
in Table 1. The methods are the radial basis function SVM, the SVMs using the scaled dot product
kernel raised to the first, second and third power, Parzen windows, Fisher’s linear discriminant, and
the two decision tree learners, C4.5 and MOCI, The next five columns are the false positive, false
negative, true positive and tue negative rates summed over three cross-validation splits, followed
by the cost, which is the number of false positives plus twice the number of false negatives. These
five columns are repeated twice, first using the threshold learned from the training set, and then
using the threshold that minimizes the cost on the test set. The threshold optimization is not
possible for the decision tree methods, since they do not produce ranked results,
Leamed threshold Optimized threshold
Class Method FP_FN TP TN Cost| FP_FN TP TN Cost
Proteasome Radial SVM 3 7 28 29 I7| 4 5 30 2S
Dot-product-1 SVM | 14 11 24 2418 36| 2 7 28 2430 16
Dotproduct2 SVM | 4 13 22 2428 30] 4 6 29 2428 16
Dot-product3 SVM | 3 18 17 2429 30] 2 7 28 2430 16
Parzen 215 30 241 31] 3 9 26 2429 2
FLD 7 12 23 2425 31/12 7 28 2420 26
cas 17 10 25 2415 37) - - = -
Moc 1017 18 2422 44
Histone Radial SVM 02 9 256 4[0 2 +9 U6 4
Dot-product-lSVM| 0 4 7 24596 8] 0 2 9 256 4
Dotproduct2SVM| 0 5S 6 2456 10] 0 2 9 2456 4
Dot-product-3 SVM] 0 8 3 2456 16] 0 2 9 2456 4
Parzen 203 8 m5 06s] 1 3 8 SS 7
FLD 0 3 8 2456 6) 2 1 10 254 4
C45 22 9 24 6
MOCcL 205 6 4M RB] - = - -
Helic-tumheix Radial SUM T 16 0 2450 33] 0 16 0 asl 32
Dotproduct-1 SVM] 20 16 0 2431 52] 0 16 0 2451 32
Dotproduct-2SVM| 4 16 0 247 36] 0 16 0 2451 32
Dot-product3 SVM] 1 16 0 2450 33] 0 16 0 2451 32
Parzen 4 16 0 2437 46] 0 16 0 245132
FLD 14 16 0 2437 46] 0 16 0 2451 32
cas 2 16 0 2449 34
MOC 6 16 0 2445 38] - = -
Table 3: Comparison of error rates for various classification methods (continued). See caption
for Table 2
2/22/07 CAP5510 85
Class Kermel Cost for each split Total
Tricarboxyhe acid Radial 1s 21 5 7
Dot-product-l } 15 22 18 100
Dot-product-2] 16 22 17 99
Dot-produet-3 | 162217 100
Respiration Radial 16 18 28 w
Dot-produet-1 | 24 24 29 IZ
19 19 26 ul
19 19 26 107
Ribosome ® 12 15 39
Dot-product-l} 13 18 14 7
Dot-produet2] 11 16 14 nR
Dot-product3 | 9 15 1 65
Proteasome Radial 10 9 35
Dot-produet-l } 16 12. 12 16
Dot-product2] 16 13. 15 78
Dot-product-3 | 16 _13_ 16 79
Histone Radial 4 4 4 4 4] 20
Dotproductl] 4 4 4 4 4] 20
Dotproduct2] 4 4 4 4 4] 20
Dot-produ 4 4 4 4 4] 20
Table 4: Comparison of SVM performance using various kernels. For each of the MYGD
classifications, SVMs were trained using four different kemel functions on five different random
three-fold splits of the data, training on two-thirds and testing on the remaining third. The first
column contains the class, as described in Table 1. The second column contains the kernel function,
as described in Table 2, The next five columns contain the threshold-optimized cost (i.e., the
number of false positives plus twice the number of false negatives) for each of the five random
turee-fold splits. The final column is the total cost across all five splits.
2/22/07
Family Gene Locus Error Description
TCA — YPROOIW CIT3 FN _milochondnial amare synthase
YORI42W LSCL FN subunit of succinyl-CoA ligase
YNROOIC CITL — FN mitochondrial citrate synthase
YLRI74W IDP2 EN _ isocitrate dehydrogenase
YILI2W KGD1 FN _a-ketoglutarate dehydrogenase
YDRI48C KGD2 FN _ component of a-ketoglutarate dehydrogenase
complex in mitochondria
YDLO66W IDP1 EN _ mitochondrial form of isocitrate dehydrogenase
YBLOISW ACHI FP. acetyl CoA hydrolase
Resp YPRISIW QCR2___ FN __ubiquinol eytochrome-c reductase core protean 2
YPL271W ATPIS EN ATP synthase epsilon subunit
YPL262W FUM1 FP fumarase
YML120C NDI FP mitochondrial NADH ubiquinone 6 oxidoreductase
YKLO&SW MDH1 FP mitochondrial malate dehydrogenass
YDLO67C _COX9 FN _ subunit Vila of cytochrome ¢ oxidas
Ribo YPL037C_BGDI FP __? subunit of the nascent-polypeptide-assoaiated
complex (NAC)
YLR406C_RPL31B FN ribosomal protcin L31B (L34B) (YL28)
YLRO7SW RPLIO FP ribosomal protein L10
YALO03W_EFBI___FP__tanslation clongation factor EF-1)3
Prot YHRO27C_RPNI___FN subunit of 268 proteasome (PA700 subunit)
YGR270W YTA7 FN member of CDC48/PASL/SECI8 family of ATPases
YGRO48W UFDI FP ubiquitin fusion degradation protein
YDRO6IC DOA4 FN __ubiquitinisopeptidase
YDLO20C__RPN4 FN _ involved in ubiquitin degradation pathway
Tist YOLOI2C HTA3 FN histone-related protein
YKLO49C CSE4 FN required for proper kinetochore function
Table 6: Consistently misclassified genes. The table lists all 25 genes that are consistently mis-
classified by SVMs trained using the MYGD classifications listed in Table 1. Two types of errors
ary included: a false positive (FP) occurs when the SVM includes the gene in the given elass but
the MYGD classification does not; a false negative (FN) occurs when the SVM does not include
the gene in the given class but the MYGD classification does,
CAP5510
86
SVM | SVM
Dataset Features | FP | FN | FP | FN
Ovarian(origmal) | 97802 [46 [48 | 6 3
= ——- - Qvarian{madified) | 97302 [44] 34] 0 | 0
fot - Festure | FE _ EN a as AML/ALL train 72g [06] 28| o 6
corona 2 Se 2G ‘AML treatment m2 | 48/35] 3 2
Gore uendduct 3 192 2 Is Colon 200 [salar] 3 | 3
dleprodduet 402 Bo
TapaTact I? TH
dol-prod 32 u Table 5: Results for the perceptron on all data seta. The results are averaged over 5 shufllings of the data
dot-product 5 32 Hu as this algorithm is sensitive to the order in which it receives the data points. The first column is the dataset
fot mnt i = used and the second is number of features in the dataset. For the ovarian and colon datasets, the number
aotared 33 2 of normal tissues misclassified (FP) and the number of tumor tissues misclassified (FN) is reported. For the
dot-produet 3 53 2 AML/ALL training dataset, the number of AML samples misclassified (FP) and the number of ALL patients
dot-product UM x3 w misclassified (FN) is reported. For the AML treatment dataset, the number of unsuccessfully treated patients
ae ys a misclassified (FP) and the number of successfully treated patients misclassified (FN) is reported. The last two
detect 5 24 i colurnns report the best score obtained by the SVM on that dataset.
dot-pruiduet 10 43 is
det-product 0 7 3 a
Sot-prodluct 2 593 UB
dol-prosduel 3 303 uu LB
product 10 5 3 il
rr
9 2 2 s
dot-roduct 5 7 3 4
dot-prodtuct 10 5 3
Table 1: Brror rates for ovarian cancer tissue experiments.
For eadh setcing of t consisting of a Lemel snd diagonal favcor (DF), exch dame wes elaseified.
varved axe the munber of nomnsl «issues misclassified (FP
sified exarectly (TP). 2
2 ia the mmber of features felomes! used.
issues misclassified (FN), tumor tissues
nd normal
ied oonreetly (TN).
si ob
lhe (Meat
I"
Figure 1:
which is the distance of an
negative value indicates an incor
seoam] raost negative poi: oorr
VM classification margins for ovarian tissues. When dlassifving, the SV
mple from the decision boundary it las eared, In this grap
cach tisme sample caleulated using (10) is shown,
©
1
calenlates a margin
. ‘Lhe most negative
HWBC3.
2/22/07 CAP5510 90 Genomics (Cont’d) Gene Expression Microarray experiments & analysis Probe design (CODEHOP) Array image analysis (CrazyQuant) Identifying genes with significant changes (SAM) Clustering 2/22/07 CAP5510 91 Proteomics Study of all proteins in a genome, or comparison of whole genomes. Whole genome annotation & Functional proteomics Whole genome comparison Protein Expression: 2D Gel Electrophoresis 2/22/07
em ~ .
2D Gel Electrophoresis
CAP5510
92
2/22/07 CAP5510 95 Gene Networks & Pathways Genes & Proteins act in concert and therefore form a complex network of dependencies. 2/22/07
Pathway Example from KEGG
beta LACTAM RESIS TANCE
o0312 Weard2
Staphylococcus aureus
|
|
|
|
|
4
beta-Lactamase
“0 bete-Lactam
val Mecl eo
DNA Penicillin-binding protein
CAP5510
96
Pseudomonas aeruginosa
METHIONINE METABOLISM
Homocystine ©
© 2-Oxobutanoate
Glytine, serine and
threonine metabolism
O-Suecinyl-
L-homoae rine vi
©) Homoserine
13]
Cystathionine %
0 lazaaal O-Acetyl-
Laatt
Loysteine LAdtt [42.99.3) L-homoserine
$-D-Ribogyl-
[42.122][ 4418] L-homocysteine
L-Serine O
8-Ade nosyl-
L-homocysteine
N-Fomyr 35.131 Béide nosy]
L-methionine eee ‘L-Methionine 64.25 L-methionine
Aunninoacyl- TWeacl L-Methionine
L-methionie [SA 1512 | L1845 | FO oxide
4-Methylthio-
0 2129-0 6.11.10 {1.432 }—0 5 robetanoate
H-Formylme thioxyl-
TNA
Ooz71 sede
L-Methionyl-tRNA
97