Transcription and Translation - Biology - Lecture Slides, Slides of Biology

Download Transcription and Translation - Biology - Lecture Slides and more Slides Biology in PDF only on Docsity! Chapter 16 TRANSCRIPTION AND TRANSLATION docsity.com SUMMARY Review of genes, RNA and the “code Transcription Initiation Elongation and termination Translation Initiation Elongation and termination Mutations docsity.com General Scheme – 2 Steps The DNA code for a protein is copied to mRNA = transcription. mRNA code used to assemble protein = translation. docsity.com The Code A specific order of nucleotides or bases on the DNA. Occurs in blocks of 3 bases = codons that specify which amino acid goes where in a protein. 1 codon = one amino acid The code is “universal”, i.e. the codons specify the same amino acids in all organisms, pretty much. docsity.com Transcription Production of a mRNA “copy” of the DNA sequence of a certain gene. Enzyme = RNA polymerase; 1 in prokaryotes, 3 in eukaryotes. The base sequence on 1 DNA strand is used as a template = “template strand”. The other strand is the “non-template strand”, fig 16.1. docsity.com HOW TRANSCRIPTION BEGINS Non-template -35box Promoter _19 box strand CTGTTGACAATTAATCATCGAACTAGTATAATAGTACGC ~ Say ee, ~ Downstream DNA 1. Initiation begins Sigma binds to promoter region of DNA. Ce part 1 Biological Science, 2/e © 2005 Pearson Prentice Hall, Inc. = docsity.com RNA polymerase Template strand Non-template strand 2. Initiation continues Sigma opens the DNA helix; Y) transcription begins. Figure 16-3 part 2 Biological Science, 2/e © 2005 Pearson Prentice Hall, Inc. ® docsity.com Transcription Sequence in prokaryotes cont’d Elongation and termination phase Elongation: RNA polymerase adds nucleotides 5’ to 3’ at a rate of ~ 50 nucleotides/second beginning at start site. Active portion = transcription bubble. Completed mRNA strand exits bubble as it is finished. Termination: RNA polymerase stops when the RNA produces a hairpin loop. docsity.com Transcription Sequence in eukaryotes is basically the same; 3 differences: 3 types of RNA polymerase – RNA pol I produces rRNA, RNA pol II produces mRNA, and RNA pol III produces tRNA. Promoters are more complex and include sites for basal transcription factors. These replace the Sigma protein in prokaryotes, i.e. bind to DNA and open the helix. This allows for more control. docsity.com Transcription Sequence in eukaryotes – differences cont’d Posttranscriptional modifications Addition of a 5’ cap (adenine or guanine + methyl-GTP and a “poly A tail”, fig 16.7. docsity.com 5’cap Coding region of mRNA A Poly(A) tall (A) tail re 5’ ae nanan 3’ Figure 16-7 Biological Sci © 2005 Pearson Prentice Hall, Inc. ® docsity.com Translation Prokaryotes Elongation and termination phase Ribosome moves down 1 codon at a time and specific tRNA’s bring their amino acids to the chain. Amino acids are joined by peptide bonds to form the protein. 3 sites on the ribosome (APE): A = tRNA binding site, P = site of peptide bond formation, E = exit site for empty tRNA’s. docsity.com Diagram of ribosome during translation Growing polypeptide Peptide bond formation occurs here Aminoacyl tRNA 3’ The E site The P site holds The A site holdsatRNA_ the tRNA with holds an that will exit growing poly- aminoacyl peptide attached tRNA —_—_—_ & Figure 16-13b Biological Science, 2/e © 2005 Pearson Prentice Hall, Inc. docsity.com Translation Prokaryotes cont’d Elongation and termination phase Translation is terminated when the ribosome reaches a stop codon. docsity.com Translation Eukaryotes Eukaryotic genes contain sequences that do not contain codons = INTRONS; sequences that contain codons are EXONS. mRNA sequences contain the same introns and exons. docsity.com Noncoding regions must be removed from RNA transcripts. Intron1 = Intron 2 DN ee ee Promoter Exon1 Exon 2 Exon 3 Primary RNA 5 ae 3’ transcript Spliced transcript 5 Spe 3’ Figure 16-6a Biological Science, 2/e © 2005 Pearson Prentice Hall, Inc. ® docsity.com Translation Eukaryotes cont’d Introns are removed after mRNA synthesis and exons are joined together = RNA splicing. Why? Alternate splicing can produce different proteins from the same gene sequence. 30,000 genes can be used to produce 120,000 mRNA’s. docsity.com Base-pair mismatch (error in replication) 2 Wild type A Ti == De os replication C DNA replication MUTANT Original DNA iy | (‘| ai Figure 16-18 Biological Science, 2/e © 2005 Pearson Prentice Hall, Inc. ® docsity.com Point Mutations A single base change is called a point mutation. Point mutations can result from errors in DNA replication. docsity.com Sickle-Cell Disease Results from a Point Mutation in the Gene for Hemoglobin 5 3 Mutant 5 3 Normal DNA sequence of non-template (coding) strand DNA sequence of non-template (coding) strand Amino acid sequence Amino acid sequence DNA point mutation can lead to a different amino acid sequence. Phenotype Sickled red blood cells Normal red blood cells docsity.com Mutations Gene duplication – extra copy of gene is added to one chromosome during cross over. Gene inversion – piece of DNA is flipped over during cross over. Gene deletion – loss of DNA. docsity.com Other types of mutations Definition Example Consequence Produces an extra copy or deletion of one or more genes. Families of related genes arise by gene duplication. Gene Addition of a small duplication chromosome segment due to an error during crossing over at meiosis I—homologs do not align correctly Genes Af A B > > ON > > oa An (RE el eee, az a on > ON > Mutant Chromosome Change ina chromosome A A Changes gene order along inversion segment when DNA : . é chromosome. Other types breaks in two places, flips, > y o> of chromosome breaks can and rejoins c B lead to deletion or addition D D of chromosome segments. Figure 16-20b Biological Science, 2/e © 2005 Pearson Prentice Hall, Inc. 3 docsity.com Differences between Prokaryotic and Eukaryotic Gene Expression Eukaryotic genes contain introns; prokaryotic genes do not. Eukaryotic mRNA’s code for 1 gene; prokaryotic mRNA’s code for several related genes at one time. Eukaryotic mRNA must be moved to cytoplasm; prokaryotic mRNA is already in the cytoplasm and translation starts before transcription is complete. docsity.com